ID: 1132972892

View in Genome Browser
Species Human (GRCh38)
Location 16:2697552-2697574
Sequence CCCCCAGCATACCATGGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 162}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132972887_1132972892 7 Left 1132972887 16:2697522-2697544 CCAGGCTTGGAGGGAAAATGCCA 0: 1
1: 0
2: 0
3: 28
4: 194
Right 1132972892 16:2697552-2697574 CCCCCAGCATACCATGGCCTCGG 0: 1
1: 0
2: 1
3: 17
4: 162
1132972886_1132972892 10 Left 1132972886 16:2697519-2697541 CCTCCAGGCTTGGAGGGAAAATG 0: 1
1: 0
2: 1
3: 28
4: 218
Right 1132972892 16:2697552-2697574 CCCCCAGCATACCATGGCCTCGG 0: 1
1: 0
2: 1
3: 17
4: 162
1132972880_1132972892 28 Left 1132972880 16:2697501-2697523 CCCAGCAGGAAGCGTCGGCCTCC 0: 1
1: 0
2: 0
3: 8
4: 59
Right 1132972892 16:2697552-2697574 CCCCCAGCATACCATGGCCTCGG 0: 1
1: 0
2: 1
3: 17
4: 162
1132972881_1132972892 27 Left 1132972881 16:2697502-2697524 CCAGCAGGAAGCGTCGGCCTCCA 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1132972892 16:2697552-2697574 CCCCCAGCATACCATGGCCTCGG 0: 1
1: 0
2: 1
3: 17
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132972892 Original CRISPR CCCCCAGCATACCATGGCCT CGG Intronic
902523027 1:17032644-17032666 CTCCCAGCATGACATGTCCTTGG - Intronic
902983726 1:20142914-20142936 CCTCCAGCATACCAGGCACTTGG + Intronic
903331092 1:22597599-22597621 CCCCCAGCCTCCCAGGCCCTTGG - Intronic
905307049 1:37027076-37027098 CCCCCAGAAAACCATGGCCAAGG + Intronic
905874272 1:41422343-41422365 CCCCACCCATGCCATGGCCTGGG - Intergenic
907951639 1:59189146-59189168 GCCCCAACATACCATTTCCTGGG - Intergenic
910909512 1:92218487-92218509 AGCCCAGAATACCAGGGCCTTGG + Intronic
913171241 1:116234153-116234175 CCCCTGGCATTCCCTGGCCTGGG + Intergenic
916207083 1:162325542-162325564 CCCCCAGAATCACATGGGCTGGG + Intronic
916858082 1:168772535-168772557 GGCTCAGCAAACCATGGCCTGGG + Intergenic
919812000 1:201414614-201414636 CTCCCAGCATTCCTTGGCCTTGG + Exonic
920349126 1:205326085-205326107 CCCACACCATGCCATGGCCAAGG + Intergenic
920677955 1:208051370-208051392 CCCCCATCATCCAATGGCCTTGG - Exonic
920826994 1:209431648-209431670 GCCCCTGCATTCCAAGGCCTTGG + Intergenic
922179568 1:223223440-223223462 CCCCCAGCATACCCCGGCTCAGG - Exonic
922774605 1:228208890-228208912 CCCCCACCAAACCATGCCCCGGG - Intronic
1062786587 10:270136-270158 CCCACAGCTGACCATGGCTTTGG + Intergenic
1062805457 10:416386-416408 CCCCCAGCATCCCACAGCCCCGG + Intronic
1068573764 10:58660354-58660376 CCAGCAGCATACCCTGGCCCTGG + Intronic
1068612150 10:59071978-59072000 CCCCAAGGTTACCATGGCATGGG - Intergenic
1069649957 10:70039241-70039263 CCTCCAGCATTACATGGCCTGGG + Intergenic
1074441196 10:113478855-113478877 CCTCCAGCATATCCTGGGCTGGG + Intergenic
1075370022 10:121927935-121927957 CGCCCAGAAAGCCATGGCCTCGG + Exonic
1075614740 10:123882956-123882978 CAACCATAATACCATGGCCTGGG + Intronic
1075657844 10:124173786-124173808 GCCACAGCACACCAGGGCCTGGG + Intergenic
1076053829 10:127355481-127355503 CCACCAGCACCCCATGGCCTAGG - Intronic
1076422462 10:130340987-130341009 CCCCAAGCATGACATGTCCTGGG + Intergenic
1077138964 11:1015164-1015186 CCCCAGGCATCCCATGGCCTGGG + Intronic
1077232749 11:1465396-1465418 CCGCCTGCATCCCGTGGCCTGGG + Intergenic
1078050841 11:7963486-7963508 CCCCCAGATCACCATGGCCATGG - Exonic
1083331090 11:61898771-61898793 CACCCAGCATGCCTTGGCCTTGG + Intronic
1084214725 11:67641099-67641121 CACCCACCATGCCATGGCCAGGG - Intergenic
1084267382 11:68012023-68012045 CTCCCAGCATGGCATGGTCTGGG - Intronic
1085757772 11:79215870-79215892 CCTCCAGGATCCAATGGCCTTGG - Exonic
1088896583 11:114083160-114083182 CCCACAGCGCAGCATGGCCTTGG + Intronic
1096069502 12:48767133-48767155 CCCAAAGCATACCATGTCCCAGG + Exonic
1101652105 12:106686761-106686783 GCCCCAGCTTTCCTTGGCCTTGG + Intronic
1103327222 12:120129713-120129735 CCTCCAACATCCCAGGGCCTCGG + Intronic
1105292658 13:19062481-19062503 CCCCCAGCAACCCAGGGCCCAGG + Intergenic
1114499948 14:23161278-23161300 CCCCCAGCAAACCCTCGCCACGG + Intronic
1116260683 14:42621118-42621140 CCCCCAAATTAACATGGCCTTGG + Intergenic
1119618285 14:76112800-76112822 CCCCCACCCTCCCAAGGCCTGGG - Intergenic
1121902519 14:97706942-97706964 TTCTCAGCCTACCATGGCCTGGG - Intergenic
1122965288 14:105121094-105121116 CCCCCAGCAAACAACTGCCTTGG + Intergenic
1126064538 15:44816056-44816078 ACCCCATACTACCATGGCCTAGG + Intergenic
1129161625 15:73751240-73751262 CCCCCAGCCCACCCTGGCCCTGG + Exonic
1129877869 15:78988589-78988611 CCGCCAGCACACCATATCCTGGG - Intronic
1130327202 15:82890424-82890446 CCAGCAGCACCCCATGGCCTAGG + Intronic
1130712624 15:86298821-86298843 CCCCCAGCATTCCATAGCCGTGG - Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1132800221 16:1748359-1748381 CCCCCAGGACCCCAGGGCCTGGG - Intronic
1132972892 16:2697552-2697574 CCCCCAGCATACCATGGCCTCGG + Intronic
1134068569 16:11246265-11246287 CCCCCAGCATGCCCAGCCCTGGG - Intergenic
1141700383 16:85639533-85639555 CCCCCATCATCCCTTGTCCTTGG + Intronic
1142157104 16:88537613-88537635 CCCCCACCAGACCACCGCCTGGG + Intergenic
1142173440 16:88634460-88634482 CCCCCAGCAGACCACGCCCCCGG - Intergenic
1143094158 17:4468013-4468035 CCCCCAGTTTACCATGGCAGGGG + Intronic
1147143914 17:38474503-38474525 CCTCCAGTATGCCATGGCCCAGG - Intronic
1147582412 17:41634850-41634872 CACCCAGCATTCCAGGGCCCTGG + Intergenic
1148463406 17:47850824-47850846 GCCCCAGCCTCCTATGGCCTTGG - Intronic
1148587560 17:48791653-48791675 TTTCCAGCATGCCATGGCCTCGG - Intronic
1150981093 17:70142486-70142508 ACCTCTGGATACCATGGCCTTGG - Intergenic
1152294188 17:79457109-79457131 CCCCCAGGAGCCCATGCCCTGGG - Intronic
1152409962 17:80118219-80118241 CCGCCAGCAGCCCATGGCCCTGG + Intergenic
1152496017 17:80672309-80672331 GCTCCAGCATAGCAAGGCCTCGG + Intronic
1152577591 17:81149630-81149652 CCCCCAGCCCACCCTGGGCTTGG + Intronic
1154390042 18:13928966-13928988 CCTTCAGCATAACATGGTCTTGG + Intergenic
1156446145 18:37238384-37238406 TCCCGAGCATCCCAAGGCCTGGG + Intergenic
1157424371 18:47572124-47572146 CCCCCTGCTTCCCAGGGCCTTGG + Intergenic
1160512726 18:79461448-79461470 ACCCCAGCCTCCCAAGGCCTGGG - Intronic
1161305690 19:3566268-3566290 CCCCTAGCATCCCCTGGCCCCGG - Intronic
1162139743 19:8578631-8578653 CCCCCAGCAGAGCCTGGCCCAGG + Intergenic
1162733131 19:12730931-12730953 CCCCCACCTGCCCATGGCCTGGG - Exonic
1163572355 19:18089981-18090003 CCCCCAGCTGACCCTGGCCTGGG - Intronic
1164690907 19:30210218-30210240 CCCCCAGCAGGCCATGGTATGGG - Intergenic
1164767408 19:30782306-30782328 GCCTAAGCATACCACGGCCTGGG + Intergenic
1165159706 19:33808763-33808785 CACCCAGCCTCCCTTGGCCTGGG - Intronic
1165340933 19:35211771-35211793 ACACCAGCATACCAGGGGCTGGG + Intergenic
1166186114 19:41140218-41140240 TCCACAGCAAACCATGGCCAAGG + Intergenic
1166995535 19:46717954-46717976 GCACCAGTATACCATGGCATCGG - Intergenic
1168120198 19:54247691-54247713 TCCCCAGCACAGCAGGGCCTGGG + Intronic
1168121165 19:54253342-54253364 TCCCCAGCACAGCAGGGCCTGGG + Intronic
925868261 2:8247548-8247570 CCCCCAGCCCACCCTGCCCTGGG + Intergenic
928436305 2:31256865-31256887 CCCCCAGCATTGCATGGCCTTGG + Intronic
929268028 2:39940517-39940539 GCCCCAGAATTCCAGGGCCTTGG - Intergenic
929603926 2:43222303-43222325 CCCCCACCATGCCAAGACCTGGG + Intergenic
933813414 2:86047635-86047657 CGCCCAGCAGAGCCTGGCCTGGG + Intronic
933919824 2:87034152-87034174 CCCCAAGCAGACCATGCCCAGGG + Intergenic
933928216 2:87120888-87120910 CCCCAAGCAGACCATGCCCAGGG + Intergenic
933931802 2:87159632-87159654 CCCCAAGCAGACCATGCCCAGGG - Intergenic
934003170 2:87735743-87735765 CCCCAAGCAGACCATGCCCAGGG - Intergenic
935716368 2:105942752-105942774 CCCCTACCAGTCCATGGCCTGGG + Intergenic
936361315 2:111805802-111805824 CCCCAAGCAGACCATGCCCAGGG + Exonic
937297759 2:120820019-120820041 TCCCCAGGTTCCCATGGCCTTGG - Intronic
938210739 2:129464166-129464188 CCCCCAGCCGACCACAGCCTGGG + Intergenic
938910768 2:135883893-135883915 ACCCCCACATACCATGCCCTTGG - Intergenic
941996562 2:171606730-171606752 CCACCAGCATTCCTTGGCTTGGG + Intergenic
945612554 2:212022591-212022613 CACCTATCAAACCATGGCCTAGG - Intronic
948108951 2:235439080-235439102 CCCCCACCATGACATGGCATAGG + Intergenic
948618491 2:239217076-239217098 CCCGCAGCCTGCCATGGCCCAGG - Intronic
1170869143 20:20188524-20188546 CCCCCAGGATTACATGGGCTGGG + Intronic
1171302713 20:24077821-24077843 CCAGCAGCATCCTATGGCCTAGG - Intergenic
1173417336 20:42868786-42868808 GGCCCAGAATGCCATGGCCTGGG + Intronic
1175579796 20:60089488-60089510 CCCACATCATCCCATTGCCTGGG - Intergenic
1175954733 20:62603518-62603540 CCACCTGCCCACCATGGCCTGGG + Intergenic
1179545114 21:42108373-42108395 CCACCACCCTAGCATGGCCTGGG - Exonic
1179885189 21:44310860-44310882 CCACCATCATCCCAGGGCCTGGG - Intronic
1179934403 21:44592961-44592983 CCCCCACCATGCCATGGCCCAGG - Intronic
1180029952 21:45200204-45200226 CCCCCAACCTACCATGGCCCTGG - Intronic
1182685711 22:32120768-32120790 CCCCAAGCAGACCCTAGCCTTGG + Intergenic
1184552375 22:45211155-45211177 CTGCCAGCAAACCATGGCCCCGG + Intronic
1185063421 22:48618904-48618926 CCACCAGCCTCCCAGGGCCTAGG - Intronic
1185373484 22:50471426-50471448 CCCACAGCACACGCTGGCCTGGG - Intronic
953493764 3:43369672-43369694 CCCCCTCCATACCATGGCCCTGG - Intronic
961451888 3:127005913-127005935 CCCCCAGGTGACCAGGGCCTGGG - Intronic
965698987 3:171440075-171440097 CGCCCAGCCTAGCATGGTCTTGG - Intronic
969243203 4:5915496-5915518 CCTCCAGCATACATTGGCCAGGG - Intronic
969524626 4:7697893-7697915 CCACCAGCACAGGATGGCCTGGG + Intronic
969606428 4:8204463-8204485 CCTCCAGAACACCATGGCCAGGG - Intronic
971506313 4:27369971-27369993 CCCCCAGGAGAACATGGTCTAGG + Intergenic
975224820 4:71859107-71859129 CCCCAAATTTACCATGGCCTGGG + Intergenic
975259170 4:72276005-72276027 TCTCCAGCATTACATGGCCTTGG - Intergenic
985488888 5:167563-167585 CCCCCGGCTCACCATGGCCCTGG + Intronic
986706909 5:10460123-10460145 CCCACAGCTTACCCTGGCCAGGG + Intronic
987355739 5:17061927-17061949 CCCCGAATTTACCATGGCCTGGG - Intergenic
987776524 5:22373381-22373403 CCCACATCACACCATGGCCAAGG + Intronic
991365871 5:65867387-65867409 CCCCCAGAATTCCATGGGATGGG + Intronic
991660913 5:68949867-68949889 CCTCCAGCATACTATGCCTTAGG - Intergenic
993059491 5:83021827-83021849 CCTCAAGCATCCTATGGCCTAGG - Intergenic
994710508 5:103259125-103259147 GCCCCAGCGTCCCTTGGCCTTGG + Intronic
997420352 5:133762210-133762232 CCCCCAACATACCACAGGCTAGG + Intergenic
999641825 5:153680187-153680209 CCCCCAGCAGCACATGGCCTTGG + Intronic
1001099014 5:168798610-168798632 CCCTCATCATGCAATGGCCTTGG - Intronic
1001470138 5:172006312-172006334 CCCCCAGCCTTCCCTGGCCTCGG - Intronic
1001527233 5:172437543-172437565 CTCCCAGCATCCCAAGGCCTTGG + Intronic
1002599546 5:180346465-180346487 CCCCCACCCCACCAGGGCCTCGG + Intronic
1002817542 6:693894-693916 CCCCCAGCATCCCACGACCCCGG - Intergenic
1007273112 6:40653330-40653352 TCTCCATCATACCATGGCCATGG + Intergenic
1007419909 6:41713136-41713158 TCCCCAGCTTACCAGGGCCCTGG + Intronic
1007521230 6:42452864-42452886 CCCCCACCGCACCCTGGCCTCGG + Intergenic
1017913381 6:158814099-158814121 CACACAGCACACCATGTCCTGGG + Intronic
1020076617 7:5262846-5262868 CCTCCTGGATACCATGGCCCTGG - Intergenic
1021209089 7:17823049-17823071 GTTCCAGCATCCCATGGCCTTGG + Intronic
1021792185 7:24216885-24216907 CCCCCAGCTTACAAGGTCCTTGG + Intergenic
1025202473 7:56970748-56970770 CCTCCTGGATACCATGGCCCTGG + Intergenic
1025669475 7:63606179-63606201 CCTCCTGGATACCATGGCCCTGG - Intergenic
1025992026 7:66503912-66503934 TCCCCATCAGACCATGGCCATGG + Intergenic
1026553269 7:71385693-71385715 CCCCCAGCAGGCCATGGGCACGG + Intronic
1041031138 8:53736332-53736354 CCACAAACATAACATGGCCTAGG - Intronic
1044806503 8:96013609-96013631 CCCCCAGTAGACCATGTCATAGG + Intergenic
1044878427 8:96696879-96696901 CTCCCAGCAAACCAAAGCCTGGG + Intronic
1049216362 8:141410122-141410144 ACCCCCTCATGCCATGGCCTGGG + Intronic
1049571306 8:143371463-143371485 CCCCCAGGATCCCCTGGCCCTGG - Intronic
1049979850 9:894057-894079 CCCGCAGTACTCCATGGCCTTGG + Exonic
1052764836 9:32630443-32630465 CACCCAGCCTACCTTGGCCCTGG + Exonic
1056438445 9:86596199-86596221 CCTGCTCCATACCATGGCCTTGG - Intergenic
1057267712 9:93630146-93630168 CCCCCAGCAACCCAGGGCCCAGG - Intronic
1058229556 9:102408964-102408986 TCTCCAGCATACCATGACTTTGG + Intergenic
1058532405 9:105919615-105919637 CCTCCAGCACCCCATGGCCAGGG + Intergenic
1058783431 9:108362472-108362494 CTACCAGAATACCATAGCCTGGG - Intergenic
1059298809 9:113296680-113296702 CCCGCTGCCTCCCATGGCCTGGG + Intergenic
1059429309 9:114240535-114240557 CCCCCAGCCTGCCCTGTCCTGGG + Intronic
1060148130 9:121268956-121268978 CCCCCAGCCTTCCAAGGACTGGG - Intronic
1060737117 9:126073161-126073183 CCACCAGTACACCATGGCCAAGG - Intergenic
1060827166 9:126693874-126693896 GCCCCAGCTCACCCTGGCCTAGG - Intronic
1061450062 9:130662980-130663002 CACCCAGCATGTCAGGGCCTGGG + Intergenic
1061811363 9:133164153-133164175 CCCGCACCCTACCATGGCCCCGG - Intergenic
1062092756 9:134687115-134687137 CCCCACGCATGCCACGGCCTGGG - Intronic
1062325478 9:136010544-136010566 TCCCCAGCCCACCATGGCTTGGG - Exonic
1185782800 X:2863755-2863777 CCCTGAGCATACCATAGCCTGGG + Intronic
1189135643 X:38546759-38546781 CTGCCAGCATACCTTGTCCTAGG + Intronic
1189734384 X:44054721-44054743 CTCCCAGCATTCCATGTACTAGG + Intergenic
1190109268 X:47579456-47579478 CCCACAGCATACCAGGTGCTTGG - Intronic
1190879949 X:54484917-54484939 CCCCCAGAAAGCCATGGCTTGGG + Intronic
1195762755 X:108264485-108264507 TCTCCTGCATACCATGGCCTAGG - Intronic
1199687304 X:150275630-150275652 GCTCCAGCATACCACTGCCTAGG - Intergenic
1200153005 X:153960400-153960422 TCCCCCAGATACCATGGCCTGGG - Exonic
1202169231 Y:22023497-22023519 AGCCCAGAATACCATGGCATTGG + Intergenic
1202222130 Y:22562868-22562890 AGCCCAGAATACCATGGCATTGG - Intergenic
1202320985 Y:23632799-23632821 AGCCCAGAATACCATGGCATTGG + Intergenic
1202549782 Y:26037257-26037279 AGCCCAGAATACCATGGCATTGG - Intergenic