ID: 1132973175

View in Genome Browser
Species Human (GRCh38)
Location 16:2698772-2698794
Sequence GGCACCAAGGGAGCTCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 182}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132973175_1132973188 16 Left 1132973175 16:2698772-2698794 CCTGCTGGAGCTCCCTTGGTGCC 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1132973188 16:2698811-2698833 GGGCTCCTTGTCTGTGGGGCAGG 0: 1
1: 0
2: 1
3: 34
4: 294
1132973175_1132973180 -9 Left 1132973175 16:2698772-2698794 CCTGCTGGAGCTCCCTTGGTGCC 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1132973180 16:2698786-2698808 CTTGGTGCCACTGAGGGATCTGG 0: 1
1: 0
2: 0
3: 15
4: 127
1132973175_1132973182 -5 Left 1132973175 16:2698772-2698794 CCTGCTGGAGCTCCCTTGGTGCC 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1132973182 16:2698790-2698812 GTGCCACTGAGGGATCTGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 209
1132973175_1132973183 -4 Left 1132973175 16:2698772-2698794 CCTGCTGGAGCTCCCTTGGTGCC 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1132973183 16:2698791-2698813 TGCCACTGAGGGATCTGGAGGGG 0: 1
1: 0
2: 2
3: 20
4: 216
1132973175_1132973187 12 Left 1132973175 16:2698772-2698794 CCTGCTGGAGCTCCCTTGGTGCC 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1132973187 16:2698807-2698829 GGAGGGGCTCCTTGTCTGTGGGG 0: 1
1: 0
2: 1
3: 25
4: 214
1132973175_1132973185 10 Left 1132973175 16:2698772-2698794 CCTGCTGGAGCTCCCTTGGTGCC 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1132973185 16:2698805-2698827 CTGGAGGGGCTCCTTGTCTGTGG 0: 1
1: 0
2: 1
3: 23
4: 213
1132973175_1132973186 11 Left 1132973175 16:2698772-2698794 CCTGCTGGAGCTCCCTTGGTGCC 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1132973186 16:2698806-2698828 TGGAGGGGCTCCTTGTCTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 142
1132973175_1132973181 -6 Left 1132973175 16:2698772-2698794 CCTGCTGGAGCTCCCTTGGTGCC 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1132973181 16:2698789-2698811 GGTGCCACTGAGGGATCTGGAGG 0: 1
1: 0
2: 0
3: 37
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132973175 Original CRISPR GGCACCAAGGGAGCTCCAGC AGG (reversed) Intronic
900154225 1:1197659-1197681 GGCACCAAGGGAGGTGGCGCAGG - Exonic
900408016 1:2500895-2500917 GGCACAGTGGGGGCTCCAGCGGG - Intronic
900428283 1:2590379-2590401 GGGACCCAGAGAGCTGCAGCTGG - Exonic
900923296 1:5687477-5687499 AGGACCAAGGGAGCTGCTGCCGG + Intergenic
901300266 1:8195250-8195272 GGCACCATGGGGGATCCAGAGGG + Intergenic
903666710 1:25012360-25012382 GGCACCAAGGAAGCAGCAGGGGG + Intergenic
904172576 1:28601827-28601849 AACACCAAGGGGCCTCCAGCTGG - Intronic
904559056 1:31384655-31384677 GGCACTGAGGGAGCCCTAGCAGG - Intergenic
905636940 1:39560166-39560188 AGCACCAAGCAAGCTCCAGGAGG + Intergenic
905965718 1:42093544-42093566 TGAACCAAGGCTGCTCCAGCTGG + Intergenic
907438740 1:54465436-54465458 GGGGCCATGAGAGCTCCAGCGGG - Intergenic
907750874 1:57262049-57262071 GTCAGCAAGGGATTTCCAGCTGG + Intronic
913445212 1:118943813-118943835 GGCTCCCAGGGAGCACGAGCAGG + Intronic
917114092 1:171584505-171584527 GTCACCAAGTGCTCTCCAGCAGG + Exonic
920513684 1:206568603-206568625 GTCCTCCAGGGAGCTCCAGCTGG + Intronic
921346169 1:214187532-214187554 GGCGCCAAGGGGGCTTCAGGGGG + Intergenic
922787532 1:228290402-228290424 GGCACCAGAGGGGGTCCAGCAGG - Intronic
923055593 1:230424535-230424557 AGGCCCAAGGGACCTCCAGCTGG - Intronic
923361777 1:233218954-233218976 GGAGCCAGGAGAGCTCCAGCAGG + Intronic
1062879950 10:969986-970008 AGCACCCAGGGACCTCCTGCAGG - Intergenic
1064630803 10:17308841-17308863 AACACCAAGGGAGCTGCAGAGGG + Intergenic
1067270096 10:44784209-44784231 GGAACTAAGGGAGCTACAGGAGG - Intergenic
1067663341 10:48252678-48252700 GGCAGAAAGGGAGCCGCAGCAGG + Intronic
1069156137 10:65034009-65034031 TGCAGCAAGGGAGATGCAGCTGG + Intergenic
1069513074 10:69056583-69056605 GGCTCTAAAGGAGCGCCAGCAGG - Intergenic
1070679153 10:78436579-78436601 TGCACCAGGGAAGCTCCTGCAGG + Intergenic
1070778993 10:79126753-79126775 GGCACCTGGGGAGCCACAGCAGG + Intronic
1071571836 10:86701376-86701398 GGCTCCAAGAGAGCTCCGACAGG - Intronic
1072451813 10:95544741-95544763 GGGGTCAAAGGAGCTCCAGCAGG - Intronic
1072549108 10:96463690-96463712 GGTCCCAAGGGAGCTGGAGCTGG - Intronic
1075622658 10:123939302-123939324 GGCACCAAGCGGGGCCCAGCAGG + Intronic
1075678337 10:124313422-124313444 GGCAGGAAGGGAGGTCCAGGAGG + Intergenic
1076525445 10:131109769-131109791 GGGAACAGAGGAGCTCCAGCCGG - Intronic
1076684685 10:132192803-132192825 GGCACCAAGGCAGCGCTAGCAGG + Exonic
1077539219 11:3138781-3138803 GGGACCAAGGGAGAAGCAGCTGG + Intronic
1077912600 11:6586608-6586630 AGCACCAGGGGAGCTTCCGCCGG - Intronic
1079078360 11:17397256-17397278 GGCAGACATGGAGCTCCAGCTGG - Exonic
1080661035 11:34296191-34296213 GGCATCAAGGGAGCTCAATGTGG - Intronic
1082722698 11:56697810-56697832 GGAACCAAGGGAACTCCAAGGGG - Intergenic
1083777584 11:64901854-64901876 CTCACCACGGGAGCTCCAGATGG + Intronic
1084189648 11:67493212-67493234 GGCAACTAGGGAGATGCAGCTGG - Intronic
1084752874 11:71215456-71215478 GGCACCGAGGGAGCTTCAGATGG + Intronic
1085390478 11:76179556-76179578 GGCCCCATGGGTGCTGCAGCTGG - Intergenic
1085461304 11:76695526-76695548 TGTACCCAGTGAGCTCCAGCAGG + Intergenic
1085517878 11:77121963-77121985 GCCACAGAGGGAGCTCCAGCAGG - Exonic
1088823881 11:113477566-113477588 GGCACCAAACGACCTCCAGAGGG - Intergenic
1088850479 11:113699778-113699800 GGCACCCACAGAGCTCCAACAGG + Intronic
1089922032 11:122218152-122218174 GAAAACAAGGGAGATCCAGCTGG + Intergenic
1091182469 11:133619154-133619176 GACACAATGGGAGCTCCAGGCGG + Intergenic
1091280385 11:134378575-134378597 GGCACCCAGGCAGCTGCATCTGG - Intronic
1092111714 12:5969268-5969290 GGCAGACAGGGACCTCCAGCTGG + Exonic
1096106105 12:48997830-48997852 GGCACCGAGATAGCTCCTGCGGG - Exonic
1096231320 12:49898343-49898365 GGTCCCCAGGGAGCCCCAGCCGG - Intronic
1101244854 12:102875582-102875604 GGCGCCAAGGTTGCTCCAGGTGG - Intronic
1102034488 12:109762991-109763013 GGCACCTAGCAACCTCCAGCTGG - Intronic
1103794589 12:123494586-123494608 GGCCCCACGGGAGCTCAGGCTGG - Intronic
1103933782 12:124464643-124464665 GGCACCAAAGAAGTGCCAGCTGG - Intronic
1104259573 12:127170507-127170529 GGAACCAAGGGAGTCCCCGCAGG - Intergenic
1104765221 12:131325943-131325965 GGAACCATGGGAGATCCAGGAGG - Intergenic
1104765236 12:131325987-131326009 GGAACCATGGGAGATCCAGGAGG - Intergenic
1113543840 13:111131240-111131262 GGCACCAAGGGAGCCCAGGAGGG + Intronic
1118302587 14:64628538-64628560 GGCACCAAGGCAGTTTCAGGTGG - Intergenic
1119208441 14:72812065-72812087 TGCCCCAAGTGAGCTCCAGGAGG + Intronic
1121422347 14:93824596-93824618 TGCTCCCAGGGAGCCCCAGCAGG + Intergenic
1122400089 14:101461865-101461887 GGCCCCAAAGCAGCTCCACCAGG - Intergenic
1122938706 14:104971734-104971756 GGCAGCCAGGAGGCTCCAGCAGG + Intronic
1124621128 15:31274723-31274745 GGAACCAAGGGACACCCAGCAGG - Intergenic
1124803258 15:32856045-32856067 TGCACCAAGGGAACAGCAGCTGG + Intronic
1125490895 15:40147679-40147701 GGCCCCAGGGCAGCTCCAGAAGG + Intergenic
1126646665 15:50881756-50881778 GCCAACATGGGAGATCCAGCAGG + Intergenic
1128289940 15:66470662-66470684 GGCACAAAGATAGCTCAAGCTGG + Intronic
1128370742 15:67037256-67037278 GGCACCATGGGAACCCCGGCTGG - Intergenic
1131250655 15:90828089-90828111 GACACCCAGGGCGCCCCAGCAGG + Intergenic
1132385514 15:101397541-101397563 GGGACCAGGGGAGTTCCAGCAGG - Intronic
1132578635 16:675271-675293 TGCAAGCAGGGAGCTCCAGCCGG + Intronic
1132655939 16:1041674-1041696 GGCAGCCTGGGAGCTCCAGCAGG + Intergenic
1132973175 16:2698772-2698794 GGCACCAAGGGAGCTCCAGCAGG - Intronic
1133099373 16:3469993-3470015 GGCCCCAGGGCAGCCCCAGCAGG - Intronic
1133262352 16:4559178-4559200 GACTCCCAGGGAGATCCAGCTGG - Intronic
1135040843 16:19115460-19115482 GGCCCTCAGGGAGCTCCAACAGG - Exonic
1139579332 16:67862990-67863012 GGCACCTTGGAAGCTGCAGCAGG + Intronic
1139700368 16:68704394-68704416 TCCACCAAGGGAGCGCTAGCAGG - Intronic
1141745046 16:85919974-85919996 GGCACCATGGGATCTCAAACTGG - Intronic
1142233341 16:88910033-88910055 GGCACCAAGCGAGGAACAGCCGG - Intronic
1142349659 16:89574407-89574429 GGCGCCCAGGCAGCTCCTGCAGG - Intergenic
1142712495 17:1730998-1731020 GGCACCAAGAGAGCCCGGGCCGG - Intronic
1143336483 17:6175350-6175372 GCCACCACGGGATGTCCAGCTGG + Intergenic
1148020212 17:44548329-44548351 AGCAGGAGGGGAGCTCCAGCTGG + Intergenic
1148521092 17:48275682-48275704 GGAATCAAGGGAGCTCCTGAGGG + Intronic
1148837044 17:50470758-50470780 GGCACTGAGAGAGCTCCAGCTGG + Intronic
1151838108 17:76597449-76597471 GCCACCCAGTGACCTCCAGCTGG + Intergenic
1156298914 18:35818212-35818234 TGCACCCAGGGAGCACCACCAGG + Intergenic
1156578813 18:38351421-38351443 GGCAACAAGGGGCCTCCTGCGGG - Intergenic
1157711518 18:49852970-49852992 GTCACCAAAGGAGCCCCAGCAGG - Intronic
1157741431 18:50096815-50096837 TGGACCTAGGGAGCTCCAGCAGG - Intronic
1160832017 19:1108564-1108586 GGCCGCAAGGCAGCGCCAGCGGG + Exonic
1161356736 19:3823289-3823311 GGCTCAAAGGAAGCTCCCGCGGG - Exonic
1161467956 19:4442619-4442641 GGCAGCAAGGGAGGGCCAGGTGG + Intronic
1161642550 19:5433323-5433345 GGCACCAAGGGAGCTTCTGAGGG + Intergenic
1162003507 19:7763281-7763303 GGAACCAAGGGTGCAGCAGCTGG + Exonic
1163063538 19:14776675-14776697 GGTAGCGAGGAAGCTCCAGCGGG - Intronic
1164512079 19:28905581-28905603 GGCCCCATGGAAGCTCCTGCAGG + Intergenic
1164986097 19:32649858-32649880 GTCCCCAAAGGCGCTCCAGCTGG + Intronic
1165004831 19:32796164-32796186 GGCACTGAGGGTGCTCCAGACGG + Intronic
925911755 2:8578352-8578374 GACCCCAAGGGAGATCCAGAAGG + Intergenic
926642448 2:15252055-15252077 GGCATAAAAGGATCTCCAGCAGG + Intronic
927468208 2:23352359-23352381 TGCACCCAGGGAGCTCCATGAGG + Intergenic
929329544 2:40664177-40664199 GGAACAAAGGGAGATCAAGCAGG + Intergenic
930962302 2:57276486-57276508 AGCAGCCAGGAAGCTCCAGCTGG - Intergenic
931537391 2:63293894-63293916 TGCAGCATGGGAGCTCCAGAAGG + Intronic
934650545 2:96089158-96089180 GGACCCCAGTGAGCTCCAGCGGG + Intergenic
935781057 2:106509645-106509667 GCCACCCAGGGAGCTGGAGCAGG + Intergenic
937330066 2:121021151-121021173 GGCACCAAGGGAGATGCCACAGG + Intergenic
939634231 2:144561326-144561348 GGAACAAAGGGAGCTGCTGCTGG + Intergenic
941433154 2:165435969-165435991 GGACCAAAGGGAGCTCCTGCTGG - Intergenic
944156952 2:196617682-196617704 GGCAGAAAGGGAGCCCCAGGTGG - Intergenic
948289638 2:236815784-236815806 GGCTCCCAGGGCTCTCCAGCAGG + Intergenic
948767963 2:240233226-240233248 GGCACCCAGGGGTCTGCAGCCGG + Intergenic
1169219616 20:3814424-3814446 GGCACCAGTGGAGCTCCAAAAGG + Intergenic
1170869164 20:20188843-20188865 GGCATCAGGGGACTTCCAGCAGG - Intronic
1172836089 20:37874051-37874073 GGCTGCAAGTGAGCACCAGCAGG - Intergenic
1173224258 20:41152773-41152795 GACACCAGGGAAGCACCAGCAGG + Intronic
1173357324 20:42306270-42306292 GGCCCCAACAGAGCTCCAGCAGG + Intronic
1174167373 20:48594635-48594657 GGAACCAGGAGAGCTCCAGATGG - Intergenic
1175138417 20:56842216-56842238 TGCAGCAAGGGAGGTGCAGCTGG + Intergenic
1175912605 20:62411995-62412017 GGCTCAATGGCAGCTCCAGCTGG - Intronic
1176015440 20:62928781-62928803 GGGGCCAAGAGCGCTCCAGCAGG + Intronic
1182464377 22:30505472-30505494 TGTACCATGGGGGCTCCAGCCGG + Intronic
1182751775 22:32647230-32647252 GGGACCCAGGGATCTCCAGAAGG + Intronic
1182753577 22:32660637-32660659 GGGACAAGGGGAGCTCCAGAAGG - Intronic
1183673422 22:39286410-39286432 GGCTCCAAGGGAGCTCTGGCAGG - Intergenic
1185136101 22:49073509-49073531 GGGACCAGGGGAGCTTCAGGTGG + Intergenic
950028260 3:9835123-9835145 GGCAACAAGGCACTTCCAGCTGG - Exonic
950094131 3:10318557-10318579 GACCCCAAGGGAGCTACAGCTGG + Intronic
950141289 3:10617831-10617853 TGCCCCAAGGGAGCACGAGCTGG + Intronic
952336417 3:32407071-32407093 GGCACCAAGGGAGTCCCTGCTGG + Intronic
952979824 3:38725737-38725759 GGCTCTTAGGGAGCTCCAGGTGG - Intronic
953665363 3:44922310-44922332 AGAACCAAGGGACCTCCAGATGG - Intronic
953703464 3:45214038-45214060 GGCACCAGGGGAGGTGCATCTGG + Intergenic
954415512 3:50391413-50391435 GGCACCAAGTGTGGTCCGGCAGG + Intronic
955065065 3:55526846-55526868 AGCACCAAGGGAGGGCCAGGAGG - Intronic
960014504 3:112871613-112871635 GGCTCCCAGGAAGCTCCTGCTGG + Intergenic
960971874 3:123145676-123145698 CGGACCACGGGAGCTGCAGCAGG - Intronic
961483169 3:127196959-127196981 GGCACCAAGGCAGCTGGAGGGGG - Exonic
962320868 3:134389301-134389323 GTCTCCCAGGGAACTCCAGCTGG - Intergenic
963745305 3:149119142-149119164 GGAACCAAGGCAGCCCCCGCCGG + Intergenic
966860342 3:184228231-184228253 AACACACAGGGAGCTCCAGCTGG - Intronic
975102557 4:70531168-70531190 GCCACCCAGGGAACCCCAGCAGG + Exonic
978763214 4:112377916-112377938 GGCACCAGGGGTGAACCAGCAGG + Intronic
979328032 4:119401538-119401560 GGGAACACGGGAGGTCCAGCAGG + Intergenic
983245854 4:165285867-165285889 GGGAACACGGGAGGTCCAGCAGG + Intronic
986166732 5:5279152-5279174 GACACACAGGAAGCTCCAGCAGG - Intronic
990324289 5:54659786-54659808 GGCACCAATGGAGCTGAAGCAGG + Intergenic
990342657 5:54839026-54839048 TGCACCAGGGGAGAACCAGCTGG + Intergenic
990487190 5:56270783-56270805 AGCTCCAAAGGAGGTCCAGCTGG - Intergenic
992479234 5:77134190-77134212 GGCACAGCTGGAGCTCCAGCTGG + Intergenic
998561732 5:143178655-143178677 GGCACCAAGGGAGCCCCCATGGG - Intronic
1001416114 5:171545699-171545721 GGGACCATGGGCCCTCCAGCTGG + Intergenic
1001960762 5:175879151-175879173 GGATCCAGGGGAGCCCCAGCAGG - Intronic
1002792209 6:444949-444971 GGCACCGAGGGGGCCCCTGCAGG + Intergenic
1002945881 6:1760342-1760364 GGTAAGAAGGGAGCTCCAGGGGG + Intronic
1003181303 6:3794179-3794201 TGCACCAGGGGAGTTCCAGCAGG - Intergenic
1003425736 6:5997186-5997208 GAGACCAAGGGGGCTGCAGCAGG - Intergenic
1004365387 6:15008459-15008481 GGCAAATAGGGAGCTCCAGCAGG + Intergenic
1004399008 6:15271219-15271241 GGGACCAAGGGAGGTTCAGGAGG + Intronic
1004570939 6:16844285-16844307 GGGACCCAGGGAGCACCCGCTGG + Intergenic
1005893406 6:30158398-30158420 GCCAGCAAGGGAGCTCCTGACGG - Exonic
1005999837 6:30956203-30956225 GACACCAAGGCAGCCCCACCTGG + Intergenic
1007183365 6:39946793-39946815 GGCACCTAGGGAGGGCCAGGTGG + Intergenic
1007809864 6:44478085-44478107 GGCAGCAAGGGAGAGCCAGGTGG + Intergenic
1008405732 6:51116752-51116774 AGCAGCTTGGGAGCTCCAGCAGG + Intergenic
1008953180 6:57183026-57183048 GGCACCAAAGGAGCCCAAGTAGG - Intronic
1012550534 6:100461146-100461168 GCCACCAAGAGGACTCCAGCGGG + Intronic
1012848384 6:104418424-104418446 TGCACCAAGGGAGGTTTAGCAGG + Intergenic
1016885412 6:148955222-148955244 GGCACCAAGGGAGCTGGGTCTGG + Intronic
1019308695 7:348387-348409 AGCAACAAGGGACCCCCAGCAGG - Intergenic
1020101468 7:5396640-5396662 GGCAGCAAAGCACCTCCAGCTGG + Intronic
1020109833 7:5441804-5441826 GGCAGGAAGGGAGTTCCAGGAGG - Intronic
1021531126 7:21646636-21646658 GGTGCCCAGTGAGCTCCAGCAGG + Intronic
1022721867 7:32948708-32948730 GCCAGCTAGGGACCTCCAGCTGG - Intergenic
1022787868 7:33656970-33656992 AGCACCAAGGGAGCGCAAGATGG - Intergenic
1023905598 7:44519641-44519663 GGCCCTAAGGGAGCTCGTGCTGG - Intronic
1025095598 7:56093164-56093186 GAGGCCAAGGGAGCTCCAGAGGG - Intergenic
1026131087 7:67621520-67621542 CGCACCAAGGGAACTGCAGGTGG - Intergenic
1027333818 7:77127150-77127172 TGCACCCAGGGAGCTCCCGCAGG + Intronic
1029781974 7:102744164-102744186 TGCACCCAGGGAGCTCCCGCAGG - Intergenic
1031613809 7:123857239-123857261 GACACCAAGCTAGCTCCAGGAGG - Intronic
1032086815 7:128888812-128888834 GGCACCCCGGGAGCCCCAGCAGG + Intronic
1035609436 8:950075-950097 GGCACCAAGGCAGGTGCTGCCGG - Intergenic
1044995639 8:97835694-97835716 GGCTCCAAGGCACCACCAGCAGG - Intronic
1045047197 8:98290786-98290808 AGAACCAAGAGAGCTGCAGCGGG + Intronic
1047575626 8:126151098-126151120 TGCACAAAGGGAACTCCATCAGG + Intergenic
1049405366 8:142449865-142449887 GGCGCCCGGGGGGCTCCAGCAGG + Exonic
1050814222 9:9788713-9788735 GCCACCAGGTGAGCTCCAGGTGG + Intronic
1052799647 9:32955964-32955986 GGCGCCCATGGGGCTCCAGCCGG - Intergenic
1055406006 9:75974255-75974277 GGACCGACGGGAGCTCCAGCCGG + Intronic
1061662855 9:132141769-132141791 AGCTCCACGGCAGCTCCAGCTGG + Intergenic
1062307770 9:135919479-135919501 GGCACCATGGGGGCACCCGCTGG - Intergenic
1062450051 9:136611362-136611384 GGGACCCAGGGAGCTCCAGGAGG + Intergenic
1187611822 X:20951638-20951660 GGCCCCCAGTGAGCTCAAGCTGG - Intergenic
1189784038 X:44543213-44543235 GGTACAAAGGGAGAACCAGCTGG + Intergenic
1192262249 X:69512368-69512390 GGCACCAGGCGAGCTGCAGCTGG + Intronic
1196544542 X:116946801-116946823 AGCAGCAGGGAAGCTCCAGCTGG - Intergenic
1198441920 X:136671789-136671811 CCCTCCAAGGCAGCTCCAGCTGG - Intronic