ID: 1132973175

View in Genome Browser
Species Human (GRCh38)
Location 16:2698772-2698794
Sequence GGCACCAAGGGAGCTCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 182}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132973175_1132973183 -4 Left 1132973175 16:2698772-2698794 CCTGCTGGAGCTCCCTTGGTGCC 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1132973183 16:2698791-2698813 TGCCACTGAGGGATCTGGAGGGG 0: 1
1: 0
2: 2
3: 20
4: 216
1132973175_1132973187 12 Left 1132973175 16:2698772-2698794 CCTGCTGGAGCTCCCTTGGTGCC 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1132973187 16:2698807-2698829 GGAGGGGCTCCTTGTCTGTGGGG 0: 1
1: 0
2: 1
3: 25
4: 214
1132973175_1132973182 -5 Left 1132973175 16:2698772-2698794 CCTGCTGGAGCTCCCTTGGTGCC 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1132973182 16:2698790-2698812 GTGCCACTGAGGGATCTGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 209
1132973175_1132973180 -9 Left 1132973175 16:2698772-2698794 CCTGCTGGAGCTCCCTTGGTGCC 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1132973180 16:2698786-2698808 CTTGGTGCCACTGAGGGATCTGG 0: 1
1: 0
2: 0
3: 15
4: 127
1132973175_1132973188 16 Left 1132973175 16:2698772-2698794 CCTGCTGGAGCTCCCTTGGTGCC 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1132973188 16:2698811-2698833 GGGCTCCTTGTCTGTGGGGCAGG 0: 1
1: 0
2: 1
3: 34
4: 294
1132973175_1132973185 10 Left 1132973175 16:2698772-2698794 CCTGCTGGAGCTCCCTTGGTGCC 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1132973185 16:2698805-2698827 CTGGAGGGGCTCCTTGTCTGTGG 0: 1
1: 0
2: 1
3: 23
4: 213
1132973175_1132973181 -6 Left 1132973175 16:2698772-2698794 CCTGCTGGAGCTCCCTTGGTGCC 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1132973181 16:2698789-2698811 GGTGCCACTGAGGGATCTGGAGG 0: 1
1: 0
2: 0
3: 37
4: 275
1132973175_1132973186 11 Left 1132973175 16:2698772-2698794 CCTGCTGGAGCTCCCTTGGTGCC 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1132973186 16:2698806-2698828 TGGAGGGGCTCCTTGTCTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132973175 Original CRISPR GGCACCAAGGGAGCTCCAGC AGG (reversed) Intronic