ID: 1132973939

View in Genome Browser
Species Human (GRCh38)
Location 16:2702260-2702282
Sequence GCGGTGGCAGGCGCGTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 242}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132973933_1132973939 16 Left 1132973933 16:2702221-2702243 CCATTTCCTGAAGCGTCGGCAGT 0: 1
1: 0
2: 1
3: 2
4: 52
Right 1132973939 16:2702260-2702282 GCGGTGGCAGGCGCGTCCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 242
1132973931_1132973939 20 Left 1132973931 16:2702217-2702239 CCATCCATTTCCTGAAGCGTCGG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1132973939 16:2702260-2702282 GCGGTGGCAGGCGCGTCCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 242
1132973934_1132973939 10 Left 1132973934 16:2702227-2702249 CCTGAAGCGTCGGCAGTCTTTGC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1132973939 16:2702260-2702282 GCGGTGGCAGGCGCGTCCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132973939 Original CRISPR GCGGTGGCAGGCGCGTCCTG AGG Intronic
901948100 1:12719662-12719684 ACGGTGGCGGGGGCGTCATGGGG + Exonic
902148729 1:14425269-14425291 GCTATGGCAGGAGCTTCCTGAGG - Intergenic
902875515 1:19338516-19338538 GCGGCGGGAGGTGCGTGCTGCGG + Intergenic
904086719 1:27914505-27914527 GCAGTGGCGGCCGCGTTCTGTGG - Exonic
904500103 1:30908484-30908506 GCGGTGGCAGGAGCAGCCCGCGG + Exonic
906315450 1:44784192-44784214 GCGGGGGCAGGCGAGACCTCAGG + Exonic
907223858 1:52927220-52927242 GCGGGGTGGGGCGCGTCCTGTGG - Exonic
909775056 1:79473727-79473749 GTGGTGGCAGGCACCTCCTCGGG + Intergenic
911188646 1:94927140-94927162 GCGGAGGCGGGGGCGGCCTGTGG - Exonic
911468337 1:98283264-98283286 GCCGAGGCAGGCGCATCATGAGG - Intergenic
915517576 1:156422007-156422029 GAGGTGGCAGGCGGGTCTCGGGG - Intronic
917344212 1:174012113-174012135 GAGGTGGCAGGGGTGGCCTGAGG + Intronic
917864644 1:179182028-179182050 GCTGAGGCAGGCGGGTCATGAGG - Intronic
923191768 1:231626883-231626905 GCGGCGGCTGGGGCGCCCTGAGG - Exonic
924669850 1:246112945-246112967 GCTGTGGCAGGCGGATCATGAGG + Intronic
1063049757 10:2434073-2434095 GCTGAGGCAGGCGGGTCATGAGG + Intergenic
1063630949 10:7733328-7733350 GCCGAGGCAGGCGGGTCATGAGG - Intronic
1065372858 10:25007666-25007688 GCCGAGGCAGGCGGGTCATGAGG - Intronic
1065533735 10:26698110-26698132 GCGGTGGGATCCGTGTCCTGGGG + Intronic
1066407004 10:35127454-35127476 GAGGAGGCAGGCGGGTCCCGGGG - Exonic
1068331601 10:55578451-55578473 GCGGAGGCGGGCGCATCGTGAGG - Intronic
1068606228 10:59008096-59008118 GCGGAGGCAGGTGGATCCTGTGG + Intergenic
1070510588 10:77157205-77157227 GCTGAGGCAGGCGGGTCCCGAGG + Intronic
1076519600 10:131073437-131073459 GCAGGGGCAGGCCCCTCCTGGGG - Intergenic
1076724890 10:132408646-132408668 GCGGTGTCAGAAGCTTCCTGAGG + Intronic
1076783136 10:132735460-132735482 CCGGTGGCACGGGCGCCCTGGGG + Intronic
1078210326 11:9265145-9265167 GCGGCGGGAGGGGCGGCCTGAGG - Exonic
1078771793 11:14358698-14358720 GCGGGGGCTGGCGCTACCTGTGG - Intronic
1079193797 11:18305964-18305986 GCTGTGGCAGGCGGATCTTGAGG - Intronic
1080969430 11:37253427-37253449 GCGGAGGCAGGCGGATCATGAGG - Intergenic
1083052566 11:59790347-59790369 GCTGTGGAATGCACGTCCTGTGG + Intronic
1083857214 11:65399231-65399253 GCCGAGGCAGGCGGGTCATGAGG - Intronic
1084000148 11:66291765-66291787 GCGGTGCCAGGCGCTGCCGGCGG + Intergenic
1084014622 11:66371351-66371373 GCGGAGGCGGGTGCGTCCTCGGG - Intronic
1084502835 11:69544997-69545019 GCGGAGGCAGGCGGATCATGAGG + Intergenic
1087280288 11:96202097-96202119 GCCGAGGCAGGCGCATCATGAGG + Intronic
1089359545 11:117876729-117876751 TGGCTGGGAGGCGCGTCCTGCGG + Exonic
1090732753 11:129585875-129585897 GCCGAGGCAGGCGAATCCTGAGG - Intergenic
1090880834 11:130830381-130830403 GACTTGGCAGGCGAGTCCTGAGG - Intergenic
1091543597 12:1484812-1484834 GAGGTGGCAGGCGCATCACGAGG - Intronic
1092140036 12:6177620-6177642 GCCGAGGCAGGCGGATCCTGAGG - Intergenic
1092372430 12:7928163-7928185 GCCGTGGCAGGCGGATCATGAGG + Intronic
1092483982 12:8885595-8885617 GTGGTGGCATGTGCCTCCTGTGG - Intronic
1095194407 12:39296301-39296323 GCCGAGGCAGGCGGGTCATGAGG - Intronic
1096178362 12:49537975-49537997 GCGCTGGCAGGCAAGTCCGGGGG + Intergenic
1097668971 12:62513710-62513732 GCTGAGGCAGGCGGGTCATGAGG + Intronic
1103566287 12:121817452-121817474 GCGGCGGCCGGCGCGGCCTCTGG + Exonic
1104965563 12:132507463-132507485 GCGGAGGCTGGAGTGTCCTGGGG + Intronic
1105602779 13:21901935-21901957 GCGGTGGCAGGAGCAGCATGGGG + Intergenic
1105851672 13:24340715-24340737 GCGGTGGCTGGCGAGTCCCCAGG - Intergenic
1109127401 13:58534305-58534327 GCGGAGGCAGGCGGATCATGAGG + Intergenic
1109692266 13:65909399-65909421 GGGGTGGCAGGCTGGTCCTTGGG + Intergenic
1110573103 13:77027100-77027122 GCGGTGGCAGCCGCTCGCTGAGG - Exonic
1114305267 14:21417618-21417640 GCCGAGGCAGGCGCATCATGAGG + Intronic
1114438535 14:22727899-22727921 GAGGAGGCAGGCGCATCATGAGG + Intergenic
1118673968 14:68162549-68162571 GCGGAGGCAGGCGAATCATGAGG + Intronic
1118806052 14:69237776-69237798 GCGCCGGCAGGTGCGTTCTGGGG + Exonic
1120998228 14:90432940-90432962 GCAGTGCCTGGCACGTCCTGAGG - Intergenic
1122931395 14:104934215-104934237 GTGGGGGCAGGCTTGTCCTGGGG + Exonic
1123034790 14:105467494-105467516 GTCCTGGCAGGCACGTCCTGTGG + Intronic
1123716727 15:23039274-23039296 GCGGAGGCGGGCGCGGCCTCAGG - Intronic
1125327023 15:38546458-38546480 GAGGTGGCAGGCGAATCGTGAGG - Intronic
1127925717 15:63538778-63538800 GCCGAGGCAGGCGGGTCATGAGG - Intronic
1131157428 15:90083858-90083880 GCCGTGGCAGCCCCTTCCTGAGG + Exonic
1131838709 15:96415067-96415089 GAGCTGGCAGGCGCGTCCATGGG - Intergenic
1132514628 16:360446-360468 GGCCTGGCAGGCGCGCCCTGGGG - Intergenic
1132821201 16:1872098-1872120 GCTGTGGCCCGAGCGTCCTGTGG - Exonic
1132973939 16:2702260-2702282 GCGGTGGCAGGCGCGTCCTGAGG + Intronic
1133294429 16:4744163-4744185 GCTGAGGCAGGCGGATCCTGAGG - Intronic
1133786794 16:8980190-8980212 GCGGAGGCAGGCGGATCATGAGG + Intergenic
1134618345 16:15669132-15669154 GCTGAGGCAGGCGGATCCTGAGG - Intronic
1134859353 16:17547255-17547277 GCCGTGGCAGGCGGATCATGAGG + Intergenic
1134956612 16:18385052-18385074 GCCGTGGCTGGCGCTGCCTGTGG - Intergenic
1138230452 16:55332205-55332227 GAGGTGGCAGAGGCGTCCTAGGG + Intergenic
1139249592 16:65482035-65482057 GCCTTGGCAGGCTCGTCCTTTGG - Intergenic
1140482499 16:75269287-75269309 GCTGAGGCAGGCGTGTCATGAGG - Intergenic
1141724766 16:85780523-85780545 GCAGCGGCAGGCGCCTCCTCGGG + Intronic
1142894542 17:2965355-2965377 ACGGTGCCTGGCGCCTCCTGAGG + Intronic
1143183419 17:4997650-4997672 GCCGTTGGAGGCGCGTCCAGGGG - Intergenic
1144496578 17:15749720-15749742 TCAGTGGCAGGCGCGGCCGGTGG + Intergenic
1144520253 17:15948192-15948214 GCGGTGGCAGGTGGGGGCTGTGG - Intronic
1144863777 17:18322243-18322265 GCCGAGGCAGGCGCATCGTGAGG - Intronic
1144905000 17:18634979-18635001 TCAGTGGCAGGCGCGGCCGGTGG - Intergenic
1151673829 17:75588205-75588227 GCGGTGGCAGGCTCGGCCGCCGG - Intergenic
1152069122 17:78126446-78126468 GAGCTGGGAGGCCCGTCCTGAGG + Intronic
1152400732 17:80064912-80064934 GCGGTGCTGGGCCCGTCCTGTGG + Intronic
1152750617 17:82060852-82060874 GCGGTGTCAGGCAGGTGCTGGGG - Exonic
1160772800 19:840658-840680 GCCGTGGCAGGTGTGTCCCGTGG - Intergenic
1160977404 19:1800069-1800091 GCCTTGGCAGGCACGTCCTGCGG + Exonic
1161006663 19:1940715-1940737 GCGGTGGCGGGCGCGGCGCGGGG - Intergenic
1161698387 19:5782742-5782764 GCAGAGGCAGGGGCCTCCTGGGG - Intergenic
1161977348 19:7613773-7613795 GGGGTGGTAGGAGCGTGCTGGGG - Intronic
1162412417 19:10514533-10514555 GCGATGGCAGCCGCGGCCTGGGG - Exonic
1162526221 19:11208511-11208533 GCGGAGGCAGGCAGGTCATGAGG - Intronic
1163679813 19:18674668-18674690 GTGGTGGCAGGATCGTCCTCTGG - Intergenic
1164208051 19:23074229-23074251 GCTGTGGCGGGCGGGTCTTGAGG - Intergenic
1164543778 19:29142314-29142336 GCAGTGGCAGGCTCTGCCTGGGG + Intergenic
1166778676 19:45328228-45328250 GAGGTGGCAGCCTCTTCCTGAGG - Intergenic
1167158961 19:47755464-47755486 GCGGCGGCAGGCGCGGCGGGAGG + Exonic
1167624665 19:50579594-50579616 GCCGAGGCAGGCGCATCATGAGG + Intergenic
1168311117 19:55461327-55461349 GAGGCGGCAGGCGCGACCCGGGG + Intronic
1168413868 19:56156818-56156840 GCGGGGACAGGCGCGCCTTGTGG - Intronic
925349612 2:3191678-3191700 GAAGTGGCAGCCGCTTCCTGGGG - Intronic
927477246 2:23423329-23423351 GGGGTGGGAGGCACGGCCTGGGG - Intronic
932232392 2:70093617-70093639 GCGGAGGCAGGCGGATCATGAGG + Intergenic
932751192 2:74372758-74372780 GTGCTGGCAGGCACCTCCTGGGG - Intronic
933351653 2:81160107-81160129 GCGGTGGCGGGCGCCTGTTGTGG - Intergenic
936096199 2:109532071-109532093 GAGGTGGCTGGCACATCCTGGGG + Intergenic
936713665 2:115161578-115161600 GCGGTGGGGGGCGCGGACTGCGG + Intronic
938379757 2:130829845-130829867 GCTGAGGCAGGCGGATCCTGAGG + Intergenic
938606944 2:132904052-132904074 GCTGAGGCAGGCGGATCCTGAGG + Intronic
942450788 2:176106982-176107004 GCGGTGGCAGATGCGCCCAGCGG + Intronic
943639588 2:190343815-190343837 GCGGCCGCAGGCGCGGCCAGAGG - Exonic
944720912 2:202422538-202422560 GCTGAGGCAGGCGGGTCATGAGG - Intronic
945404126 2:209424232-209424254 GCGGTGGCAGTCGCGACCGCGGG + Intronic
945744609 2:213705016-213705038 GCGGAGGCAGGCGGATCATGAGG + Intronic
946185493 2:217978556-217978578 GCGGGGGCAGGGGCGGGCTGGGG - Intronic
948824245 2:240566688-240566710 GCGGTGGGAGGCGCTCCCTTGGG + Intronic
1170964015 20:21050435-21050457 GCAGTGGCAGGGGTGCCCTGAGG + Intergenic
1172443805 20:34982740-34982762 GCGAAGGCAGGCGCGTCAGGTGG - Intronic
1172687266 20:36765574-36765596 GCGGAGGCAGGCGGATCATGAGG + Intronic
1172702799 20:36863280-36863302 GCGGGTGCAGGCGCGGGCTGGGG + Exonic
1172895030 20:38294429-38294451 GCCGGGGCAGGACCGTCCTGTGG - Intronic
1174717072 20:52770815-52770837 GAGGTGTCAGGCGCGGCCTAAGG + Intergenic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175776347 20:61656235-61656257 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776353 20:61656255-61656277 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776359 20:61656275-61656297 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175905305 20:62376659-62376681 GCCGAGGCAGGCGGATCCTGAGG - Intergenic
1176104063 20:63377421-63377443 GCGGTGGGAGGCGTGTGCTCCGG - Intronic
1176135414 20:63520233-63520255 CGGGCAGCAGGCGCGTCCTGGGG + Intergenic
1176156921 20:63626744-63626766 GCGGTGGCGGGCGCGGGCGGCGG - Intronic
1176383929 21:6127655-6127677 TCGGAGGCGGGCGGGTCCTGAGG + Intergenic
1177629793 21:23711750-23711772 GCCGAGGCAGGCGGGTCATGAGG + Intergenic
1178507249 21:33171934-33171956 GCGGTGGCAGCGGCCTCCTTGGG - Intergenic
1178880019 21:36441997-36442019 GGGGTCGCAGGCCCATCCTGGGG - Intergenic
1179739545 21:43410583-43410605 TCGGAGGCGGGCGGGTCCTGAGG - Intergenic
1179970462 21:44834442-44834464 GAGGTGGCGGGCGCATCGTGAGG - Intergenic
1180999956 22:19983399-19983421 GCCTTGGCAGGCAGGTCCTGAGG - Intronic
1181934459 22:26429120-26429142 GCGGCGGCGGGCGCGGCCTCGGG + Intergenic
1184071967 22:42152242-42152264 GGGGTGAAAGGGGCGTCCTGGGG + Intergenic
1184858037 22:47157099-47157121 GGGGTGCAAGGCGCCTCCTGTGG + Intronic
949259323 3:2086599-2086621 GCTGAGGCAGGCGGATCCTGAGG + Intergenic
951719301 3:25680672-25680694 GCGGAGGCAGGCGGATCATGAGG - Intergenic
954618583 3:51983210-51983232 GGAGTGGCAGGCGTGTCGTGTGG + Exonic
955291118 3:57693063-57693085 GCGGAGGCAAGCGCGCTCTGCGG - Exonic
958895612 3:99826008-99826030 GCGGAGGCAGGCGGATCATGAGG - Intronic
960051755 3:113245887-113245909 GCCGTGGCATGGGCGTCCAGGGG + Intronic
960310997 3:116116460-116116482 GCCGAGGCAGGCGGGTCATGAGG + Intronic
962296162 3:134189524-134189546 GCCGAGGCAGGCGGGTCATGAGG + Intronic
962508487 3:136073199-136073221 GCCGTGGCAGGCGGATCATGAGG - Intronic
963081929 3:141402491-141402513 GCGGGGCGAGGCGCGGCCTGCGG + Intronic
964121972 3:153194521-153194543 ACCGTGGCAGGCGGGTCATGAGG - Intergenic
969411538 4:7031671-7031693 CCGCTGGCAGGCTGGTCCTGGGG + Exonic
969458943 4:7317472-7317494 GCGGTGGCAGGCCCGCCCAGAGG - Intronic
972739887 4:41879191-41879213 GAGGCTGCAGGCACGTCCTGCGG + Intergenic
973226379 4:47789784-47789806 GCTGAGGCAGGCGCATCATGAGG + Intronic
975602054 4:76111772-76111794 GCGGAGGCAGGCACATCATGAGG - Intronic
975784548 4:77874121-77874143 GTGGTGGCAGGCGCCTACTTAGG - Intronic
976605002 4:86974380-86974402 ACCGAGGCAGGCGCATCCTGAGG - Intronic
977600557 4:98929757-98929779 CCGGTGGCAAGCGGGTACTGCGG - Intronic
978297126 4:107218521-107218543 GCCGTGGCAGGCGGATCATGAGG - Intronic
979231398 4:118352540-118352562 GCGGCGGCGGACGCGTCCTCGGG + Exonic
979864558 4:125737459-125737481 GCGGAGGCAGGCGGATCATGAGG + Intergenic
982970412 4:161977376-161977398 GCCGAGGCAGGCGGGTCATGAGG + Intronic
983373940 4:166899747-166899769 GCTGAGGCAGGCGGGTCATGAGG - Intronic
983943562 4:173562015-173562037 GCTGAGGCAGGCGGGTCATGAGG + Intergenic
984341852 4:178467269-178467291 GCTGAGGCAGGTGGGTCCTGAGG - Intergenic
985125018 4:186684469-186684491 GCGGAGGCAGGTGCATCCCGGGG - Intronic
985708586 5:1415444-1415466 GCGCTGGAAGGCAGGTCCTGAGG - Intronic
987681570 5:21143281-21143303 GCAATGGCAGGATCGTCCTGTGG + Intergenic
997673052 5:135692081-135692103 GCCGAGGCAGGCGGATCCTGAGG + Intergenic
997893006 5:137691850-137691872 GCTGAGGCAGGCGGGTCATGAGG - Intronic
1001497912 5:172202765-172202787 GCCGAGGCAGGCGGGTCATGAGG + Intronic
1004547450 6:16612091-16612113 GCTGAGGCAGGCGCATCATGAGG - Intronic
1005954424 6:30653885-30653907 GCCGTGGCAGGCGGATCATGAGG + Intronic
1006042390 6:31267205-31267227 ACTCTGGCAGGAGCGTCCTGAGG - Intergenic
1006051977 6:31352293-31352315 ACTCTGGCAGGAGCGTCCTGAGG - Intronic
1010141709 6:72621414-72621436 GACTTGGCAGCCGCGTCCTGCGG + Intergenic
1013924391 6:115450871-115450893 GCGGAGGCAGGCGAATCATGAGG - Intergenic
1017923070 6:158887967-158887989 GCTGAGGCAGGCGGATCCTGAGG + Intronic
1018390176 6:163335898-163335920 GCGGTGGCAGGAGAGGCGTGCGG - Intergenic
1019164029 6:170087376-170087398 GCGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164113 6:170087578-170087600 GCGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164163 6:170087701-170087723 GCGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164275 6:170087967-170087989 GCGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019595215 7:1855227-1855249 GCAGTGGCAGACGGGGCCTGAGG + Intronic
1019598037 7:1867424-1867446 GCGGTGGCAGCAGCTTCCTCTGG + Intronic
1019765132 7:2844268-2844290 GCGGCGGCGGACGCGGCCTGAGG - Exonic
1020008080 7:4792708-4792730 GCGCTGGCAGGCGCTTCCGTCGG + Intronic
1020086587 7:5313711-5313733 GCGGTGCCGGGCGCGCCTTGGGG + Exonic
1021358302 7:19681974-19681996 GCCGAGGCAGGCGCATCGTGAGG + Intergenic
1021868434 7:24980420-24980442 GCGGAGGGAGGCGAGTCCTGCGG + Intronic
1022350498 7:29563421-29563443 GCCGTTGCAGGCGCTTTCTGTGG - Intergenic
1023061213 7:36328809-36328831 GCCGAGGCAGGCGCATCCCGAGG + Intronic
1023854276 7:44172239-44172261 GCGGTGACAGGCAAGACCTGTGG + Intronic
1026772628 7:73212027-73212049 GCTGTGGCATCCGCTTCCTGCGG + Intergenic
1027013492 7:74765427-74765449 GCTGTGGCATCCGCTTCCTGCGG + Intergenic
1027074546 7:75180606-75180628 GCTGTGGCATCCGCTTCCTGCGG - Intergenic
1029127045 7:98301736-98301758 GCTTTGGCAGGTGCGGCCTGTGG + Intronic
1030607022 7:111648436-111648458 GCCGAGGCAGGCGGATCCTGAGG + Intergenic
1032032393 7:128495153-128495175 GCCGTGGCAGGCGGATCATGAGG - Intronic
1032298871 7:130668577-130668599 GCGGGGGAAGGGGCGTCCCGCGG + Intronic
1032592148 7:133201319-133201341 GCCGAGGCAGGCGCATCATGAGG + Intergenic
1033579361 7:142717680-142717702 GCGGTGGCAGTGGCTTCCTCTGG - Intergenic
1034287760 7:149900407-149900429 GCAGAGGCAGGCGGGTCATGAGG - Intergenic
1034663372 7:152792513-152792535 GCAGAGGCAGGCGGGTCATGAGG + Intronic
1037367965 8:18143165-18143187 GCGGAGGCAGGCGGATCCCGAGG - Intergenic
1038683005 8:29687481-29687503 GCTGAGGCAGGCGGGTCATGAGG + Intergenic
1038800788 8:30746920-30746942 GCCGAGGCAGGCGAGTCATGAGG + Intronic
1039502765 8:38030468-38030490 GAGGCGGAAGGGGCGTCCTGGGG + Exonic
1040079981 8:43275746-43275768 AGGGTGGCAGGGGCTTCCTGTGG + Intergenic
1040544621 8:48388595-48388617 GCCGAGGCAGGCGGATCCTGAGG - Intergenic
1043301460 8:78739457-78739479 GCGGAGGCAGGCGGATCATGAGG + Intronic
1047961823 8:130016654-130016676 GCGGGGGGAGGCGCGTCGCGAGG - Intronic
1049278707 8:141733084-141733106 TCGGTGCCAGGCGCTCCCTGGGG - Intergenic
1049797669 8:144504021-144504043 GAGGTGGCAGGCGGGGCTTGGGG - Intronic
1049998402 9:1051809-1051831 GAGGAGGCAGGCGCGTCCCCCGG + Exonic
1056476685 9:86959503-86959525 GCGGAGGCAGGCGAATCATGAGG + Intergenic
1056766329 9:89446797-89446819 GGAGTGGAAGGCACGTCCTGAGG - Intronic
1058389013 9:104473201-104473223 GTGGTGGCAGGCGCCTACTCAGG - Intergenic
1059064449 9:111068389-111068411 GCGGAGGCAGGCGGATCATGAGG - Intergenic
1060558360 9:124521881-124521903 GAGCTGGGAGGCGAGTCCTGTGG + Exonic
1061028984 9:128068359-128068381 GCGGTGGCGGCGGCGTCCGGCGG - Exonic
1061559750 9:131394559-131394581 GGGGTGGCGGGCGAGCCCTGAGG - Intronic
1061750254 9:132772150-132772172 GTGGTGGCAGGAGCATTCTGGGG - Intronic
1061805437 9:133135213-133135235 GCCTTGGCAGGTGTGTCCTGTGG - Intronic
1061920271 9:133778749-133778771 GTGGTGGGAGGTGGGTCCTGGGG - Exonic
1061941271 9:133885457-133885479 GCGGTGGCCGGTACTTCCTGAGG + Intronic
1062160124 9:135075388-135075410 GCGGAGAGAGGCGCGCCCTGCGG - Intergenic
1187825384 X:23330586-23330608 GCTGAGGCAGGCGGGTCATGAGG - Intergenic
1187896768 X:23989309-23989331 GTGGTGGCAGGCGCCTCAGGAGG - Intronic
1190179710 X:48181906-48181928 GCTGTGGCAGGCGGATCATGAGG - Intergenic
1194219348 X:91171780-91171802 GCCGAGGCAGGCGAGTCATGAGG - Intergenic
1197529050 X:127600262-127600284 GCGGAGGCAGGCGGATCATGAGG + Intergenic
1198631105 X:138639754-138639776 GCTGAGGCAGGCGGATCCTGAGG + Intronic
1198637015 X:138711783-138711805 GGGGTGGGAGGGGCGGCCTGCGG - Intronic