ID: 1132975777

View in Genome Browser
Species Human (GRCh38)
Location 16:2710434-2710456
Sequence GGGCCTTGGTGGCTGCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132975777_1132975784 -1 Left 1132975777 16:2710434-2710456 CCACAGTGCAGCCACCAAGGCCC No data
Right 1132975784 16:2710456-2710478 CTGACGTGGCATCTGTGTGAGGG No data
1132975777_1132975785 13 Left 1132975777 16:2710434-2710456 CCACAGTGCAGCCACCAAGGCCC No data
Right 1132975785 16:2710470-2710492 GTGTGAGGGACGATGACTTCCGG No data
1132975777_1132975783 -2 Left 1132975777 16:2710434-2710456 CCACAGTGCAGCCACCAAGGCCC No data
Right 1132975783 16:2710455-2710477 CCTGACGTGGCATCTGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132975777 Original CRISPR GGGCCTTGGTGGCTGCACTG TGG (reversed) Intergenic
No off target data available for this crispr