ID: 1132977759

View in Genome Browser
Species Human (GRCh38)
Location 16:2719206-2719228
Sequence CCATGTGCACAGGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 390}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132977759_1132977766 7 Left 1132977759 16:2719206-2719228 CCTTCCACCTCCTGTGCACATGG 0: 1
1: 0
2: 1
3: 42
4: 390
Right 1132977766 16:2719236-2719258 AGAGGGCACCATCCTTGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 149
1132977759_1132977771 17 Left 1132977759 16:2719206-2719228 CCTTCCACCTCCTGTGCACATGG 0: 1
1: 0
2: 1
3: 42
4: 390
Right 1132977771 16:2719246-2719268 ATCCTTGTGCTGGGAGACTGGGG 0: 1
1: 0
2: 1
3: 17
4: 233
1132977759_1132977776 25 Left 1132977759 16:2719206-2719228 CCTTCCACCTCCTGTGCACATGG 0: 1
1: 0
2: 1
3: 42
4: 390
Right 1132977776 16:2719254-2719276 GCTGGGAGACTGGGGGCATGGGG 0: 1
1: 0
2: 4
3: 90
4: 661
1132977759_1132977769 15 Left 1132977759 16:2719206-2719228 CCTTCCACCTCCTGTGCACATGG 0: 1
1: 0
2: 1
3: 42
4: 390
Right 1132977769 16:2719244-2719266 CCATCCTTGTGCTGGGAGACTGG 0: 1
1: 0
2: 1
3: 17
4: 231
1132977759_1132977777 28 Left 1132977759 16:2719206-2719228 CCTTCCACCTCCTGTGCACATGG 0: 1
1: 0
2: 1
3: 42
4: 390
Right 1132977777 16:2719257-2719279 GGGAGACTGGGGGCATGGGGTGG 0: 1
1: 3
2: 13
3: 115
4: 1142
1132977759_1132977767 8 Left 1132977759 16:2719206-2719228 CCTTCCACCTCCTGTGCACATGG 0: 1
1: 0
2: 1
3: 42
4: 390
Right 1132977767 16:2719237-2719259 GAGGGCACCATCCTTGTGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 149
1132977759_1132977770 16 Left 1132977759 16:2719206-2719228 CCTTCCACCTCCTGTGCACATGG 0: 1
1: 0
2: 1
3: 42
4: 390
Right 1132977770 16:2719245-2719267 CATCCTTGTGCTGGGAGACTGGG 0: 1
1: 0
2: 1
3: 13
4: 189
1132977759_1132977775 24 Left 1132977759 16:2719206-2719228 CCTTCCACCTCCTGTGCACATGG 0: 1
1: 0
2: 1
3: 42
4: 390
Right 1132977775 16:2719253-2719275 TGCTGGGAGACTGGGGGCATGGG 0: 1
1: 0
2: 1
3: 43
4: 392
1132977759_1132977772 18 Left 1132977759 16:2719206-2719228 CCTTCCACCTCCTGTGCACATGG 0: 1
1: 0
2: 1
3: 42
4: 390
Right 1132977772 16:2719247-2719269 TCCTTGTGCTGGGAGACTGGGGG 0: 1
1: 0
2: 1
3: 29
4: 227
1132977759_1132977779 30 Left 1132977759 16:2719206-2719228 CCTTCCACCTCCTGTGCACATGG 0: 1
1: 0
2: 1
3: 42
4: 390
Right 1132977779 16:2719259-2719281 GAGACTGGGGGCATGGGGTGGGG 0: 1
1: 0
2: 6
3: 99
4: 772
1132977759_1132977765 -10 Left 1132977759 16:2719206-2719228 CCTTCCACCTCCTGTGCACATGG 0: 1
1: 0
2: 1
3: 42
4: 390
Right 1132977765 16:2719219-2719241 GTGCACATGGCTTGCTCAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 143
1132977759_1132977778 29 Left 1132977759 16:2719206-2719228 CCTTCCACCTCCTGTGCACATGG 0: 1
1: 0
2: 1
3: 42
4: 390
Right 1132977778 16:2719258-2719280 GGAGACTGGGGGCATGGGGTGGG 0: 1
1: 2
2: 5
3: 74
4: 796
1132977759_1132977774 23 Left 1132977759 16:2719206-2719228 CCTTCCACCTCCTGTGCACATGG 0: 1
1: 0
2: 1
3: 42
4: 390
Right 1132977774 16:2719252-2719274 GTGCTGGGAGACTGGGGGCATGG 0: 1
1: 1
2: 8
3: 84
4: 682

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132977759 Original CRISPR CCATGTGCACAGGAGGTGGA AGG (reversed) Intronic
900392807 1:2441063-2441085 CCAGGTGCCCAGGAAGTGGAGGG + Intronic
900974951 1:6011191-6011213 CCACGTGCACAGGAGCAGGAGGG + Intronic
901001710 1:6152078-6152100 CCATTTGGGCAGGAGGTGGAGGG - Intronic
901142209 1:7042500-7042522 CCATGAGCTCAGGGGGAGGAAGG - Intronic
901327976 1:8380461-8380483 CCAGCTGCTCAGGAGGTTGAGGG - Intronic
901921347 1:12539992-12540014 CCGTGTGAGCAGGAGGTGGGTGG + Intergenic
902644424 1:17788594-17788616 CCAGGTGCAGAGGAGGAGGGTGG + Intronic
902649525 1:17827501-17827523 TCATGTGATCTGGAGGTGGAGGG + Intergenic
902981661 1:20127622-20127644 CCATGTGCAGATGAGGTTGGTGG + Intergenic
903227673 1:21902922-21902944 CCATGTGAACAACACGTGGAAGG + Intronic
903393843 1:22984227-22984249 CCATTTGCAGAGGAGATGGATGG + Intergenic
904595328 1:31640916-31640938 TCAAGTGCACAGGAGGAGGTGGG + Intronic
905051277 1:35053216-35053238 CCATCTACTCAGGAGGTAGAGGG - Intergenic
905113405 1:35615425-35615447 TCATATGCACAAGAGTTGGAGGG - Intronic
905178285 1:36151526-36151548 GCTTGAGCCCAGGAGGTGGAGGG + Intronic
905180029 1:36159953-36159975 GCATATGCAAATGAGGTGGAAGG + Intronic
905184041 1:36183533-36183555 CCACATGCACAGGCTGTGGATGG + Intergenic
905408055 1:37750692-37750714 CCAGGTGCTCAGGAGGGTGAAGG - Intronic
905424483 1:37871979-37872001 ACTTGAGCCCAGGAGGTGGAGGG + Intronic
905620018 1:39437029-39437051 CCATTTACACAGCTGGTGGAGGG + Intronic
906717996 1:47984512-47984534 CAAGGTGAACTGGAGGTGGAGGG + Intronic
907291152 1:53413832-53413854 CTGTGTGCTCAGGAGGTGGGAGG - Intergenic
908540229 1:65115270-65115292 CCTTGAGCCCAGGAGTTGGAGGG - Intergenic
911576164 1:99580969-99580991 GCATGTGCACAGGATATGCAAGG - Intergenic
912970029 1:114272436-114272458 TAATGTGCTTAGGAGGTGGAAGG - Intergenic
913525534 1:119688904-119688926 CAATGTGCATAGGAGGTTGGTGG - Intronic
915602203 1:156929487-156929509 TCATGTACAGAGGTGGTGGAGGG + Intronic
915663080 1:157419855-157419877 CCATGTCCTCAGATGGTGGAAGG - Intergenic
915837256 1:159187834-159187856 CCATGTGCACAGAAGGTAGTAGG + Intronic
916710479 1:167401573-167401595 CCATGTGCTCAGCAGGTGCATGG - Intronic
917662181 1:177187501-177187523 CCCTGTGCACAGGATGTGTGAGG - Intronic
917825418 1:178815161-178815183 ACATGAACCCAGGAGGTGGAGGG - Intronic
917829755 1:178868313-178868335 GCATGTGCCCAGGAGGATGATGG - Intronic
919573342 1:199276199-199276221 GCTTGAGCCCAGGAGGTGGAGGG - Intergenic
920204110 1:204279100-204279122 TCATCTGCACAGAAGGAGGAGGG + Intronic
922362283 1:224834122-224834144 CCAGGGGCACAGGAGGAGGAAGG - Intergenic
923017208 1:230136151-230136173 CCATCTTCTCAGGAGTTGGAGGG + Intronic
1062961694 10:1577270-1577292 TCATGCACACAGAAGGTGGATGG + Intronic
1062961706 10:1577348-1577370 TCATGCACACAGGAGGTGGATGG + Intronic
1063072400 10:2679877-2679899 CCATGAGCCCAGGGGGTGCAAGG + Intergenic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1063612052 10:7570942-7570964 CCATGTGCACAGAAGGCAGAGGG - Intronic
1064589090 10:16869809-16869831 TCATGGGAGCAGGAGGTGGAGGG + Exonic
1064897332 10:20252903-20252925 GCTTGAGCTCAGGAGGTGGAGGG + Intronic
1065059418 10:21883165-21883187 ACTTGAGCCCAGGAGGTGGAGGG + Intronic
1065305359 10:24363652-24363674 GCTTGAGCCCAGGAGGTGGAGGG - Intronic
1065367158 10:24947993-24948015 GCATGTGGATAGGAGGTGGTTGG - Intronic
1066374146 10:34842346-34842368 CCTTGAGCCCAGGAGGTTGAAGG + Intergenic
1066662847 10:37753397-37753419 CCAAGGGCACATGAGGAGGAAGG - Intergenic
1067344222 10:45426321-45426343 CCACGTGCCCTGGAGGTGGCCGG - Intronic
1067426121 10:46213384-46213406 GCTTGAGCCCAGGAGGTGGAGGG + Intergenic
1068248739 10:54408605-54408627 ACATGTGCAAAGGAGGTAGTTGG - Intronic
1068682368 10:59834014-59834036 CCAGGTGCACAGGGTGTGGTAGG - Intronic
1069021366 10:63492114-63492136 CCTTGAGCCCAGGAGGTCGAGGG - Intergenic
1069775709 10:70925995-70926017 CCAAGTGGACAGGAGCTGGTGGG - Intergenic
1071278146 10:84075428-84075450 TCATGTGCCCAGGAGAGGGAGGG + Intergenic
1071856123 10:89626157-89626179 CGCTGTGCAGAGGAGGTGGGAGG + Intronic
1071879437 10:89879313-89879335 CCTTGTACACAGGAGTTGGTGGG - Intergenic
1072589269 10:96812538-96812560 CCAGCTACTCAGGAGGTGGAAGG + Intergenic
1072748260 10:97957429-97957451 CCATGTGCACTGTAGCTGAATGG + Intronic
1073280653 10:102351629-102351651 CCATGAGCCCAAGAGATGGACGG - Intronic
1073649245 10:105341161-105341183 CAATCTGCACGGGAGGAGGAAGG + Intergenic
1075096485 10:119474819-119474841 CCCTGAGCCCGGGAGGTGGAGGG + Intergenic
1075306541 10:121373078-121373100 ACTTGAGCCCAGGAGGTGGAGGG - Intergenic
1075406805 10:122200693-122200715 CCATGTTCACATGGGGAGGACGG + Intronic
1075406828 10:122200783-122200805 CCATGTTCACATGGGGAGGACGG + Intronic
1075888589 10:125924724-125924746 ACTTGAGCACAGGAGGTGGAGGG + Intronic
1075905568 10:126078762-126078784 CCATTTGCAAATGAGGTGAAGGG + Intronic
1076286337 10:129300907-129300929 GCTTGTGCCTAGGAGGTGGAAGG - Intergenic
1077094201 11:792477-792499 CCGTGGGGACAGGAGGTGGTGGG + Intronic
1077334718 11:1998169-1998191 CCATGTGCAAAGTATGTGCAGGG - Intergenic
1077599496 11:3564133-3564155 CCTTGTGCACAGGAGGATGCTGG + Intergenic
1080241842 11:30135809-30135831 CCTTGAGCCCAGGAGGTCGAAGG - Intergenic
1081623197 11:44631220-44631242 GCCTGTGCTCAGGAGGTGGGAGG - Intergenic
1082871397 11:57946194-57946216 CCACCTGCAAAGGAGATGGATGG + Intergenic
1083852116 11:65374306-65374328 CCATGTGCCCAGGTGGAGCAGGG + Intergenic
1083852123 11:65374332-65374354 CCATGTGCCCAGGTGGAGCAGGG + Intergenic
1084255402 11:67938738-67938760 CCTTGTGCACAGGAGGATGCTGG + Intergenic
1084713818 11:70860998-70861020 CCGTGTGCCCAGCAGGTCGAGGG - Intronic
1084817347 11:71656557-71656579 CCTTGTGCACAGGAGGATGCTGG - Intergenic
1085216176 11:74834817-74834839 CCATGTGCAGAGGGGGTGATGGG - Intronic
1085446242 11:76603078-76603100 CCATGTTCTCATGTGGTGGAAGG + Intergenic
1085509499 11:77081027-77081049 CCCTGGCCACAGGAGGAGGAGGG + Intronic
1087819647 11:102697614-102697636 CCAGCTGCACAGGAGGCTGAGGG - Intronic
1087838122 11:102895064-102895086 ACTTGAGCCCAGGAGGTGGAGGG + Intergenic
1088061170 11:105652992-105653014 GCATGAACCCAGGAGGTGGATGG - Intronic
1088750658 11:112839642-112839664 CAGTGTACACAGGAGGTGGCAGG + Intergenic
1089436515 11:118473420-118473442 CCATGAGGACAAGAAGTGGAAGG + Exonic
1090195025 11:124807800-124807822 CCATGTGCATATGAGGAGGCTGG - Intergenic
1090789348 11:130076944-130076966 GCATGTGGCCAGGAGGAGGAGGG + Intronic
1091086929 11:132730094-132730116 CCTTGAACCCAGGAGGTGGAGGG - Intronic
1091193306 11:133712068-133712090 CCAAATGCACAGGGAGTGGATGG + Intergenic
1202817701 11_KI270721v1_random:53351-53373 CCATGTGCAAAGTATGTGCAGGG - Intergenic
1091722151 12:2821241-2821263 CCCTGTGCACAGCAGGTGGACGG - Exonic
1092030332 12:5278517-5278539 CCCAGTGCACAGGAGGAGGCTGG - Intergenic
1092425637 12:8373478-8373500 CCTTGTGCACAGGAGGATGCTGG + Intergenic
1092887329 12:12936506-12936528 CCAGGTACTCAGGAGGTGGGAGG - Intergenic
1092984549 12:13833386-13833408 CAATATGCAGAGGAGATGGAGGG - Intronic
1093272703 12:17083909-17083931 CAATGAGCCCAGGAGGTTGAGGG - Intergenic
1093272826 12:17085695-17085717 CAATGAGCCCAGGAGGTTGAGGG - Intergenic
1093730079 12:22557086-22557108 CACTGTGCGCATGAGGTGGAAGG - Intergenic
1093841368 12:23906385-23906407 CTAAGTCCACAGGATGTGGAGGG + Intronic
1095557409 12:43523626-43523648 CCAAGTGCACAGGAGCTGGGTGG + Intronic
1095600116 12:44003721-44003743 CCATGTGCTGAGGAGGTGGTGGG + Intronic
1097811477 12:64023969-64023991 GGATGTGCAGAGGAGGTGGTAGG + Intronic
1098019686 12:66140650-66140672 CCAGCTACTCAGGAGGTGGAGGG + Intronic
1098911150 12:76210207-76210229 TCATGTGCCCAGGAGGAGGTAGG - Intergenic
1099951640 12:89310653-89310675 CCATGTGCCCAGCTGGTTGATGG - Intergenic
1100641224 12:96484058-96484080 CCATGGGCACAGGCCGGGGATGG - Intergenic
1100791777 12:98138083-98138105 CCAAGTGCACAGAAGGAGGAAGG - Intergenic
1101339124 12:103825877-103825899 CCCGGTGCACAGCATGTGGATGG - Intronic
1102162437 12:110780653-110780675 CCATCCACACAGGAGGTGCAAGG - Intergenic
1102167021 12:110814845-110814867 CCAGGTGCCCAGAAAGTGGAAGG - Intergenic
1102168018 12:110821512-110821534 ACTTGAGCCCAGGAGGTGGAGGG - Intergenic
1103511427 12:121477464-121477486 CCTTGAGCTCAGGAGTTGGAGGG - Intronic
1103614265 12:122142213-122142235 GCATGTGGACAGGACGTGGCAGG - Exonic
1104174315 12:126315020-126315042 CCATGAGCACATGAGGTGGGTGG - Intergenic
1104436600 12:128761950-128761972 CCTTGAGCCCAGGAGGCGGAGGG - Intergenic
1104684966 12:130778893-130778915 CCATCTAGACAGGAGGTGGCGGG - Intergenic
1104964015 12:132501013-132501035 CCATGTGGCCAGGAGCTGGGCGG + Intronic
1105008858 12:132740909-132740931 CCAGGAGTACAGGAGGAGGAAGG + Intronic
1105432454 13:20349897-20349919 CCACTAGCAGAGGAGGTGGAGGG - Intergenic
1105727145 13:23174956-23174978 CCATGGTCACAGGTGGAGGATGG + Intergenic
1105987163 13:25578995-25579017 CCATGGGCACAGGAGGGGATGGG - Intronic
1108238922 13:48441211-48441233 CCATGTCCTCAGATGGTGGAAGG + Intronic
1108793616 13:54003399-54003421 GCATGTGCACAGTAAGTAGATGG + Intergenic
1110394679 13:75015598-75015620 GCTTGTGCCCAGGAGGTGAAGGG - Intergenic
1112334721 13:98504828-98504850 ACATGTGCACAAGGTGTGGATGG + Intronic
1112892190 13:104251331-104251353 CCATCTACTCGGGAGGTGGAGGG + Intergenic
1113103182 13:106743162-106743184 CCATGTGTTTAGGAAGTGGATGG - Intergenic
1113575057 13:111389366-111389388 CCGTCCGCACAGGAGGTGGTGGG + Intergenic
1113579169 13:111416808-111416830 GCATCTGCACAGGAGCTGGGTGG + Intergenic
1113732998 13:112655934-112655956 CCAGGTGGACAGGAGGTGAGAGG + Intronic
1118156782 14:63250351-63250373 CCAGCTGCTCAGGAGGTGGGAGG - Intronic
1118599959 14:67465060-67465082 CCTGGTGCACAGCAGGTGAATGG + Intronic
1120104506 14:80479228-80479250 ACATGTAAAAAGGAGGTGGAGGG + Intronic
1120721875 14:87898206-87898228 GCATGTACAGAGGAGCTGGAAGG - Intronic
1122705349 14:103617352-103617374 CCCTGTGCCCAGGAGCTGGCTGG - Intronic
1122916428 14:104861148-104861170 ACATGGGCAGTGGAGGTGGAGGG - Intergenic
1123122937 14:105926533-105926555 CCCTGGGCTCAGGAGGTAGAAGG - Intronic
1124070527 15:26388634-26388656 AGATGGGCACACGAGGTGGAGGG + Intergenic
1124662157 15:31558574-31558596 CCAAGTCCACAGGAAGTGGCGGG + Intronic
1125383818 15:39115293-39115315 CTATCTGCACAGGAGGGGTATGG - Intergenic
1125931342 15:43602261-43602283 CCATGAGTGCAGGAGGTGGAGGG - Intronic
1125944495 15:43702081-43702103 CCCTGAGCGCAGGAGGTGGAGGG - Intergenic
1127850309 15:62906516-62906538 CCAATTGCACAGGAGAAGGAAGG - Intergenic
1128146137 15:65333412-65333434 CCATCTGCAGAGGAAGGGGAGGG + Exonic
1128201750 15:65814940-65814962 CCTTGAACCCAGGAGGTGGAGGG - Intronic
1128451655 15:67809282-67809304 CCATGATCCCAGGAGGTAGATGG + Intergenic
1128611653 15:69078704-69078726 CCATCTACTCAGGAGGTGGGAGG - Intergenic
1128912053 15:71524531-71524553 CCATGAGCACAGGAGGAAGATGG + Intronic
1129477922 15:75798971-75798993 CCAGCTACACAGGAGGTGGACGG + Intergenic
1130604838 15:85306730-85306752 CCAAGTGCACGGGAGCTGGGTGG + Intergenic
1131256862 15:90868685-90868707 CCAGGTGCTCTGGAGCTGGATGG + Intronic
1131887054 15:96927350-96927372 CCATGTGACCAGGGGGTTGAAGG + Intergenic
1132317478 15:100900561-100900583 CCAAGTCCACTGGAGGGGGAGGG - Exonic
1132977759 16:2719206-2719228 CCATGTGCACAGGAGGTGGAAGG - Intronic
1133372701 16:5257437-5257459 CCTTGTGCACAGGAGGATGCTGG - Intergenic
1134021729 16:10925669-10925691 GCATGTGCACATGTGGTGAAAGG - Exonic
1135272596 16:21082303-21082325 CCAGCTGCTCAGGAGGTCGAGGG - Intronic
1135393907 16:22116569-22116591 CCATCTGCAGAGGAGGCAGAGGG + Intronic
1136286677 16:29248287-29248309 CCCTGTGCAGGGCAGGTGGATGG - Intergenic
1137458543 16:48637108-48637130 CCATGCTTCCAGGAGGTGGATGG + Intergenic
1138212968 16:55178681-55178703 CCATGTGCATAGGAGGAGGTAGG - Intergenic
1138496429 16:57411930-57411952 GCACGTGCAGAGGAGGGGGAGGG - Intronic
1139093249 16:63674858-63674880 ACTTGAGCCCAGGAGGTGGAAGG - Intergenic
1139900339 16:70323187-70323209 TCTTGAGCCCAGGAGGTGGAGGG - Intronic
1141177810 16:81732331-81732353 ACTTGAGCCCAGGAGGTGGAGGG - Intergenic
1142112140 16:88338626-88338648 CCATGTTCACAGGTTGTGGGTGG - Intergenic
1142387881 16:89778077-89778099 CCTTGAACCCAGGAGGTGGAGGG + Intronic
1143113274 17:4565617-4565639 CTATGGGCACAGAAAGTGGATGG - Intergenic
1145727323 17:27142950-27142972 ACATGTGCAAAGGAGGTAGTTGG - Intergenic
1147110731 17:38259112-38259134 ACTTGAGCCCAGGAGGTGGATGG + Intergenic
1147150750 17:38512248-38512270 CCATGCGGACATGGGGTGGAAGG - Exonic
1147289600 17:39430934-39430956 ACTTGAGCCCAGGAGGTGGAAGG + Intronic
1147724009 17:42555231-42555253 CCTTGAGCCCAGGAGTTGGAGGG + Intergenic
1147995692 17:44359221-44359243 ACAGGTGCACAGGAAGTGCAAGG - Intronic
1148220437 17:45858055-45858077 CCATGTGAACAGGATGTATAGGG - Intergenic
1148418781 17:47529318-47529340 ACTTGAGCCCAGGAGGTGGATGG - Intronic
1148469327 17:47883760-47883782 CCAGGTGCATTGGAGGTGGCAGG - Intergenic
1148544211 17:48504480-48504502 CCCTGTGCTCAGGTGGTAGATGG + Intergenic
1148709075 17:49663130-49663152 CCAGGCGCACAGGAGGTGAGAGG + Intronic
1148758755 17:49988310-49988332 CCATGCCCACGGGAGGCGGAAGG - Intergenic
1149392195 17:56203348-56203370 GAATGGGCACAGGAGATGGACGG - Intronic
1149473593 17:56940181-56940203 GCTTGAGCCCAGGAGGTGGAAGG - Intronic
1150271062 17:63865401-63865423 ACTTGAGCACAGGAGATGGAGGG + Intergenic
1150274645 17:63888602-63888624 ACTTGAGCACGGGAGGTGGAGGG + Intergenic
1151329804 17:73400083-73400105 CCATCTACGCAGCAGGTGGAGGG + Intronic
1151750016 17:76031702-76031724 GCATGAACCCAGGAGGTGGAGGG + Intergenic
1152139513 17:78528367-78528389 CCAGCTGCTCAGGAGGTGGGAGG - Intronic
1152526722 17:80892440-80892462 CCGAGTGCACACGAGGTGCATGG - Intronic
1153314521 18:3708844-3708866 CCAGGTGCACATTAGGTGGAAGG + Intronic
1154474646 18:14744557-14744579 ACTTGAACACAGGAGGTGGAGGG + Intronic
1155237473 18:23835237-23835259 CCATGGGATCTGGAGGTGGAAGG - Intronic
1155307003 18:24488251-24488273 TAATGTGGATAGGAGGTGGATGG - Intergenic
1155986861 18:32239074-32239096 CCCTGTGGCCAGGAGGGGGATGG + Intronic
1156098211 18:33561877-33561899 CCATGTTAACAGGAGGTACAAGG + Intergenic
1156228324 18:35130464-35130486 CCAGGTGCACAGGAAGAGGATGG + Intronic
1156733274 18:40222314-40222336 CCATGTGCTCAGGAGGAGATTGG - Intergenic
1157475073 18:48018790-48018812 GCTTGAGCCCAGGAGGTGGAAGG - Intergenic
1158483243 18:57841279-57841301 CCTTGAGCCCAGGAGGTAGAGGG + Intergenic
1160386109 18:78497916-78497938 CCAGGTGCACAGCAGATGCAGGG + Intergenic
1164559039 19:29275979-29276001 CCATGTGCAGAGTAGGCAGAAGG - Intergenic
1165114384 19:33520465-33520487 CCATTTGCAAAGGAGGGGCATGG - Intronic
1166023537 19:40055931-40055953 CCCTGTGCACAGGACCGGGACGG - Intronic
1166265129 19:41676805-41676827 CTATGTGTACATGGGGTGGAAGG + Intronic
1166345194 19:42161398-42161420 TCTTGTACACAGGAGGTAGAAGG - Intronic
1166845569 19:45725952-45725974 ACTTGGGCCCAGGAGGTGGAAGG - Intronic
1167761566 19:51453169-51453191 CCTTGAGCCCAGGAAGTGGAGGG - Intronic
1167953044 19:53043248-53043270 GCTTGAGCCCAGGAGGTGGAGGG - Intergenic
1168703587 19:58455533-58455555 CCATGTGCACAGGAGGTCCCTGG + Exonic
1168706092 19:58471081-58471103 CCATGTGCACAGGAGGTCCCTGG + Exonic
925362258 2:3287903-3287925 CTATGTACCCAGGCGGTGGAGGG + Intronic
925410719 2:3638434-3638456 CCCTGAGCACTGGCGGTGGAGGG + Intronic
925969738 2:9098058-9098080 CCTTGTTCTCAGGAAGTGGACGG + Intergenic
926111187 2:10184801-10184823 CCATCTGCACAAGAAGTGGATGG - Intronic
926712312 2:15891273-15891295 CCATGTGCAGAGGAGGGGGCAGG + Intergenic
927155715 2:20220049-20220071 CCATGTGGACTGGGTGTGGAGGG - Intronic
927862294 2:26567705-26567727 CCATCTGCCCAGGAGGAGGTAGG + Intronic
927976423 2:27342081-27342103 CCAGGTGGAGAAGAGGTGGATGG - Exonic
929516491 2:42607460-42607482 GCTTGAGCCCAGGAGGTGGAAGG - Intronic
929594633 2:43168557-43168579 CCAAGTGCAGAGGGGATGGAGGG + Intergenic
929703464 2:44186449-44186471 GCTTGAGCCCAGGAGGTGGAGGG - Intronic
931177766 2:59870751-59870773 GCATGAGCACAGGGGGAGGAGGG - Intergenic
931259552 2:60605256-60605278 CCAGGTCCATAGGAGGAGGAGGG - Intergenic
932048227 2:68371682-68371704 CCATGGGCTCTGGAGCTGGATGG - Intronic
932718101 2:74117489-74117511 CCAGGTACTCAGGAGGTTGAGGG - Intergenic
935223170 2:101032233-101032255 CCAGATACACAGGAGGAGGAAGG + Intronic
935701488 2:105815983-105816005 CCCGGTGAACAGCAGGTGGAAGG - Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
937352252 2:121173485-121173507 CCCTGTGTCCAGGAGGTGAAGGG + Intergenic
937888045 2:126913908-126913930 GCATGTGCACAGGAAGTGATAGG - Intergenic
938105437 2:128526799-128526821 ACATGTGCACAGGAGGCAGTGGG + Intergenic
939363188 2:141200341-141200363 ACATGGACACATGAGGTGGAGGG + Intronic
940303860 2:152204403-152204425 GCTTGAGCCCAGGAGGTGGAGGG + Intergenic
942075069 2:172350072-172350094 CCATATGGAAAGGAGGTGGAAGG + Intergenic
942148456 2:173050448-173050470 CCATCTGCACAAGGGGTGAAGGG - Intronic
943224894 2:185159706-185159728 CCTTGAACCCAGGAGGTGGAGGG + Intergenic
943446593 2:187994621-187994643 CCAAGTGCATAGGAGCTGGGTGG + Intergenic
944560679 2:200934395-200934417 CCTTGTGCCCAGGAGGTTGGGGG - Intronic
944842395 2:203636865-203636887 CCAAGTGCCTAGGAGGTGGCTGG + Intergenic
945370374 2:209009085-209009107 CCATGTTCTCATGTGGTGGAAGG + Intergenic
946874048 2:224110559-224110581 CCAAGTGCATAGGAGCTGGTGGG + Intergenic
947194654 2:227549161-227549183 TCATTTGCAAATGAGGTGGAGGG - Intronic
948137572 2:235648218-235648240 CTGAGGGCACAGGAGGTGGAGGG - Intronic
948348880 2:237322222-237322244 CAAGGTGCTCAGGTGGTGGATGG - Intergenic
948600007 2:239102323-239102345 GCACCTGCACAGGTGGTGGAGGG - Intronic
948623104 2:239249150-239249172 CGAGGTACACACGAGGTGGAGGG + Intronic
948834588 2:240620022-240620044 CCTTGTGCAGAGGAAGGGGAAGG + Intronic
1169709116 20:8541427-8541449 CCATGTGCCCAGAAGGAGAATGG - Intronic
1169829697 20:9810460-9810482 CCTTGAGCCCAGGAAGTGGAAGG + Intronic
1171266067 20:23773200-23773222 GCCTAGGCACAGGAGGTGGAAGG - Intergenic
1171456727 20:25276553-25276575 CCAGGTGCCCAGGAGGAGGCTGG + Intronic
1171959306 20:31482502-31482524 CCAGGTGAAGAGGAGGTGGTGGG - Intronic
1172219942 20:33266965-33266987 CTATGTGCTCATGTGGTGGAAGG - Intergenic
1173858221 20:46264984-46265006 CCAGGGGCACCTGAGGTGGAGGG - Intronic
1174157983 20:48528923-48528945 CCATGTGGACAGCAGAGGGATGG + Intergenic
1174483626 20:50847928-50847950 CCAGCTACTCAGGAGGTGGAAGG + Intronic
1174570460 20:51497649-51497671 CCGTGAGCAAAGGAGGGGGAAGG - Intronic
1175009486 20:55720763-55720785 CAATGTGCCCAGGGTGTGGAGGG + Intergenic
1175602800 20:60288651-60288673 CCCTGTCGACAGGAGGTTGAAGG - Intergenic
1175854663 20:62113972-62113994 CCCTGGGCACAAGGGGTGGACGG + Intergenic
1175876846 20:62234321-62234343 CCATGTGCACCTGAGTGGGAAGG + Intronic
1177151414 21:17458971-17458993 CCATGTACTCAGGAGGCTGAGGG + Intergenic
1178357253 21:31919384-31919406 GCATTTGCACAGAAGTTGGAAGG + Intronic
1179208882 21:39309334-39309356 CCAGCTACTCAGGAGGTGGAGGG + Intronic
1179817752 21:43918348-43918370 CCATGTGCTCAGGAGCTCCAGGG - Intronic
1181408303 22:22700773-22700795 CCAGGTGCCCATAAGGTGGAGGG - Intergenic
1181887209 22:26030797-26030819 CCAAGTGAAGAGGAGGAGGAAGG - Exonic
1182901869 22:33905146-33905168 CCTTGTGCCCAGGAAGTTGAGGG - Intronic
1183097484 22:35561911-35561933 CCATGTGCGAAGCCGGTGGATGG + Intergenic
1183648577 22:39140823-39140845 CCACTTGGACAGGAGGTGGCAGG + Intronic
1184693599 22:46128245-46128267 GCATGTGCTCAGGAGGAGGATGG - Intergenic
1184747487 22:46464749-46464771 GCAGGTGCAGAGGAGGTAGAAGG - Intronic
1185241303 22:49749007-49749029 CCCTGAGTACAGAAGGTGGAGGG - Intergenic
949278549 3:2318720-2318742 CCTTGAGCCCAGGAGGTGGAGGG - Intronic
949852694 3:8434764-8434786 CCATGGCCACACGATGTGGAAGG + Intergenic
950062851 3:10086562-10086584 ACTTGAGCCCAGGAGGTGGAGGG - Intronic
950672058 3:14533089-14533111 TGATGTGAACTGGAGGTGGAAGG - Intronic
950751129 3:15129009-15129031 CCTTGTGCACAGGAGGATGCTGG - Intergenic
951228611 3:20149952-20149974 GCATGTGCACAGGGGCTGAAAGG - Intronic
951983090 3:28587343-28587365 CCGTGTGCCCAGGAGGTCCAAGG + Intergenic
952804120 3:37330639-37330661 GCAAGTGGACAGGAAGTGGAGGG + Intronic
953187352 3:40651231-40651253 CCATCTGGACAGGAGGAGAAGGG + Intergenic
953390132 3:42529048-42529070 ACATGTGCACAGGAGGCAGCAGG - Intronic
953532333 3:43749828-43749850 TCTTGAGCCCAGGAGGTGGAAGG - Intergenic
953862117 3:46553568-46553590 CCCTGAGCCCAGGAGGTTGAGGG - Intronic
954224364 3:49172768-49172790 CCATGTCTGCAGGAGGTGGCCGG + Exonic
954274525 3:49533486-49533508 CCATGTGGAGTGGAGGTGGAGGG + Exonic
954886447 3:53878739-53878761 GCTTGAGCCCAGGAGGTGGAAGG + Intronic
955405046 3:58620662-58620684 CCATGTGCCCAGGTGCTGGCTGG - Intronic
955928400 3:64030693-64030715 CAAGGTGCACAGGAGGTTGGTGG + Intergenic
956480887 3:69673168-69673190 GCTTGAGCCCAGGAGGTGGAGGG - Intergenic
957070316 3:75562766-75562788 CCTTGTGCACAGGAGGATGCTGG + Intergenic
959349837 3:105248312-105248334 CCATGTCCTCACGTGGTGGAGGG - Intergenic
960025408 3:113003257-113003279 GCTTGAGCCCAGGAGGTGGAGGG + Exonic
961115208 3:124323394-124323416 CCCTGTGGGCAGGGGGTGGATGG + Intronic
961667035 3:128498938-128498960 CCATGGGCACAGCGGGTGCAGGG - Intergenic
962164388 3:133033924-133033946 CCATATGTACAGGAGGAGGGAGG + Intergenic
962494195 3:135923203-135923225 CAATGGGCAGAGGTGGTGGAGGG - Intergenic
962562696 3:136623838-136623860 CCATCTACTCAGGAGGTTGAGGG + Intronic
963814638 3:149815973-149815995 CCTTGAGCACGGGAGGTCGAGGG - Intronic
963900159 3:150726064-150726086 CCAGCTACTCAGGAGGTGGAAGG - Intergenic
964957185 3:162374507-162374529 GCTTGAGCCCAGGAGGTGGAGGG + Intergenic
967304021 3:188043358-188043380 CCAAGTACAGAGGATGTGGAAGG - Intergenic
968757174 4:2422887-2422909 CCTTGAGCCCAGGAGGTTGAAGG - Intronic
969491666 4:7502687-7502709 CCATGTGGACAGAAGCTGCAAGG + Intronic
969506149 4:7589070-7589092 CCTGGTGCACAGGAGGTGTGGGG + Intronic
969740050 4:9017985-9018007 CCTTGTGCACAGGAGGATGCTGG - Intergenic
969799213 4:9549494-9549516 CCTTGTGCACAGGAGGATGCTGG - Intergenic
970160720 4:13186283-13186305 CCTTGAGCTCAGGAGGTTGAGGG - Intergenic
970310642 4:14778877-14778899 CCATGACCATGGGAGGTGGAAGG - Intergenic
970375372 4:15451720-15451742 GCATGGGCATTGGAGGTGGATGG - Intergenic
970664064 4:18317400-18317422 CCATGAGCAAAGGAGGTGCTGGG + Intergenic
971198719 4:24492772-24492794 CCTTGAGCCCAGGAGTTGGAGGG - Intergenic
971518368 4:27516827-27516849 AAATGTGTACAGGAGGGGGAAGG + Intergenic
971722015 4:30256564-30256586 CCAAGTGCATAGGAGCTGGAAGG - Intergenic
972580675 4:40393302-40393324 GCTTGAGCCCAGGAGGTGGAGGG + Intergenic
972667944 4:41184912-41184934 TCCTGTGAACAGGAGGTGGAAGG - Intronic
974227403 4:59064671-59064693 CCATGTACCCAGGAGATGGAGGG + Intergenic
975282057 4:72572183-72572205 CCATGTGGACAGGAAGAGGAAGG - Intergenic
975546735 4:75568087-75568109 CCATGTGAAGAGGAGGAAGAGGG - Intergenic
976271378 4:83234072-83234094 GCTTGTGCCCAGGAGGTCGAGGG - Intergenic
976545665 4:86333026-86333048 CCTTGTGCCCAGGAGTTTGAGGG - Intronic
977510254 4:97953288-97953310 CCAAGTGCATGGGAGCTGGACGG - Intronic
982104527 4:152000019-152000041 GCATCTGCAGAGGAGGTGGCAGG - Intergenic
982786306 4:159540791-159540813 CTATGTGAGCAGGTGGTGGAAGG + Intergenic
983567063 4:169164495-169164517 CCAAGTACACAGCAGGTGGTGGG + Intronic
983844443 4:172499356-172499378 CCATCTGCAAAGCAGGAGGAAGG + Intronic
984294134 4:177832107-177832129 ACAGGTCCACAGAAGGTGGACGG - Intronic
984675975 4:182548140-182548162 CTGTGAGCCCAGGAGGTGGAGGG + Intronic
985641559 5:1065707-1065729 CCACGTGCAGGGGATGTGGAGGG + Intronic
985670604 5:1204674-1204696 CCCTGTGCAGAGGAGCTGGGGGG - Intronic
985920106 5:2964248-2964270 ACATGTGAACAGGAAGTGGGTGG - Intergenic
986216737 5:5726484-5726506 TCATGGACACAGGAGATGGAGGG - Intergenic
988422621 5:31024639-31024661 CCATGTGGGCAGGAGGTAGGAGG - Intergenic
989405590 5:41057405-41057427 GCAGCTGCACAGGATGTGGAAGG + Intronic
991037681 5:62144388-62144410 CCATCTGGGAAGGAGGTGGAAGG + Intergenic
991170854 5:63624074-63624096 GCATGTGCATAGGAGTGGGAAGG + Intergenic
991922422 5:71670010-71670032 CCAAGAGCACAGGAGGAGTAGGG - Intergenic
992732226 5:79683425-79683447 CCTTGAGCCCAGGAGGTTGAGGG + Intronic
993160242 5:84280827-84280849 CCATCTACACAGGAGGATGAGGG + Intronic
996487766 5:124056906-124056928 ACATGTGCGCAGGAGCTGAAGGG + Intergenic
997563081 5:134865698-134865720 GCATGTGCACAGAAGGTGAGGGG + Intergenic
997698136 5:135877783-135877805 CCAAGTGCACAGAAGGTGAGGGG + Intronic
997740436 5:136248246-136248268 TCATGTGGCCAGTAGGTGGATGG - Intronic
997801518 5:136867365-136867387 CCATGTGCGGAGGAGGCTGATGG + Intergenic
997802744 5:136882882-136882904 CCATTTTCACAGAAGGTGGATGG + Intergenic
997910696 5:137870228-137870250 GCTTGTGCCCAGGAGTTGGAGGG + Intronic
998067167 5:139169061-139169083 GCATGAGCCCAGGAGTTGGATGG + Intronic
999363661 5:151006971-151006993 CCATGGGAACAGGGGGTGGAGGG + Intergenic
1001291798 5:170468792-170468814 ACCTGAGCCCAGGAGGTGGAGGG + Intronic
1001541264 5:172541389-172541411 TCATGTACACAGGAGGCAGAGGG - Intergenic
1001597220 5:172906114-172906136 CCAAGAGCAAAGGAGCTGGAGGG - Intronic
1002608452 5:180397895-180397917 CCATGGGCACTGTTGGTGGAAGG - Intergenic
1004271567 6:14200723-14200745 CCATGTGCTCACATGGTGGAAGG + Intergenic
1005485660 6:26296886-26296908 ACAGGTGCACAGGAGGTGATCGG - Intergenic
1006233426 6:32605448-32605470 CCTTGAACCCAGGAGGTGGAGGG + Intergenic
1008624283 6:53302369-53302391 CCAAGTGGAAAGGAGGTGGAGGG - Intronic
1011125369 6:84001625-84001647 GCATGTAGACAGGAGGTGGAAGG - Intergenic
1012781879 6:103570598-103570620 GCATGTTCACAGCAGTTGGAAGG - Intergenic
1015330189 6:131968836-131968858 CCATGTGCTCTGGAGGAAGAAGG + Intergenic
1016127119 6:140417524-140417546 CCCTGTGCACAGTTGGTTGAAGG - Intergenic
1016500775 6:144718601-144718623 CCATGAGCACAGGATGAGTAAGG + Intronic
1017537546 6:155364221-155364243 CCACGAGCACAGCAGGAGGAAGG + Intergenic
1017787673 6:157769750-157769772 CCATGTGGAGAGGCAGTGGAAGG + Intronic
1018237098 6:161737151-161737173 GCAGGTGCACAGGAAGAGGAGGG + Intronic
1019571244 7:1713486-1713508 CCTTGAACACAGGAAGTGGAGGG - Intronic
1019659941 7:2218579-2218601 TCATGTGCCTTGGAGGTGGAGGG - Intronic
1021192465 7:17637420-17637442 CCATGAGAACAGCAGGAGGATGG + Intergenic
1024122702 7:46260995-46261017 CCATGGCCACAGGGTGTGGAAGG + Intergenic
1025927450 7:65971139-65971161 TCTTGAACACAGGAGGTGGATGG + Intronic
1026152286 7:67798306-67798328 CCATGACCAGGGGAGGTGGAGGG + Intergenic
1026416312 7:70184385-70184407 CCATTTCCAGAGAAGGTGGAGGG - Intronic
1027154701 7:75758401-75758423 GCTTGAGCCCAGGAGGTGGAGGG - Intergenic
1027267978 7:76504456-76504478 CCATGCGCCCGGGGGGTGGACGG + Intronic
1027319788 7:77004318-77004340 CCATGCGCCCCGGGGGTGGACGG + Intergenic
1028927485 7:96374883-96374905 GCTTGAGCCCAGGAGGTGGAGGG - Intergenic
1029072586 7:97912068-97912090 CCTTGTGCACAGGAGGATGCTGG + Intergenic
1030090882 7:105857465-105857487 CCAGTTGTCCAGGAGGTGGAAGG - Intronic
1031051319 7:116949107-116949129 CCGTGAGCTCAGGGGGTGGAGGG + Intergenic
1031371367 7:120971118-120971140 CAATGTGCACATGAGGTATATGG - Intronic
1031526371 7:122826007-122826029 CCATGGACACAGGAGGTGGTAGG - Intronic
1032229442 7:130061521-130061543 GCATGAACCCAGGAGGTGGAGGG - Intergenic
1033036481 7:137880273-137880295 CCTTCTGCACAGGAGGGGCATGG + Exonic
1033163252 7:139015889-139015911 CCATTCCCACAGGAGGTGGATGG + Intergenic
1033236328 7:139640730-139640752 GCTTGAGCCCAGGAGGTGGAAGG - Intronic
1034134968 7:148758532-148758554 ACTTGAGCCCAGGAGGTGGAGGG + Intronic
1036245080 8:7109234-7109256 CCTTGTGCACAGGAGGATGCTGG - Intergenic
1036255667 8:7204575-7204597 CCTTGTGCACAGGAGGATGCTGG + Intergenic
1036361817 8:8082927-8082949 CCTTGTGCACAGGAGGATGCTGG - Intergenic
1036889151 8:12584088-12584110 CCTTGTGCACAGGAGGATGCTGG + Intergenic
1036896739 8:12642230-12642252 CCTTGTGCACAGGAGGATGCTGG + Intergenic
1037418210 8:18674061-18674083 CCTTGAGCCCAGGAAGTGGAGGG + Intronic
1038108681 8:24467980-24468002 CCTTGAACCCAGGAGGTGGAAGG + Intronic
1038473106 8:27842179-27842201 CCATGTGCACAGTAAGGAGAAGG + Intergenic
1038795824 8:30708419-30708441 TGATGTGCACAGGACGTGGTGGG + Intronic
1039546236 8:38413435-38413457 GCAGGTGGAGAGGAGGTGGAGGG + Exonic
1039824497 8:41161526-41161548 CCAGGTGTCTAGGAGGTGGAGGG - Intergenic
1041030172 8:53728715-53728737 CCATGTGATGAGGAGGAGGAAGG - Intronic
1045809818 8:106208293-106208315 GCTTGAGCCCAGGAGGTGGAGGG + Intergenic
1046611386 8:116429461-116429483 CCATGGCCACAGCAGGAGGAAGG + Intergenic
1046679205 8:117149965-117149987 TCATGTGCACAGAATGTGGGAGG + Intronic
1047358943 8:124150091-124150113 CCATGTCCAAGGGAGGTGGAGGG - Intergenic
1047974539 8:130116257-130116279 GAATGTGCACAGGAAGGGGAGGG + Intronic
1048332785 8:133482449-133482471 CCAAGTGCACAGATGGTGGGAGG + Intronic
1048773656 8:137921873-137921895 CCATGTGTACAGGACATGCAGGG - Intergenic
1048832825 8:138493028-138493050 CCATCCACACCGGAGGTGGAGGG + Intronic
1048993546 8:139775189-139775211 CCATGTCCACAACAGGTGGGAGG + Intronic
1049235889 8:141512128-141512150 CCATGTGCCCAGCATCTGGAGGG - Intergenic
1049508758 8:143017671-143017693 CCATGTGGTCAGGAGGGGGCTGG - Intergenic
1052910855 9:33880101-33880123 CCTTGAGCGCAGGAGTTGGAGGG - Intronic
1053073750 9:35115958-35115980 ACAAGTCCACAGAAGGTGGAAGG - Intronic
1054952072 9:70863362-70863384 CCAGGTACAAAAGAGGTGGACGG - Intronic
1056840827 9:89996886-89996908 CCATGAACACTGGAGGTGAAGGG + Intergenic
1057023140 9:91716151-91716173 CCTTGAGCACAGGAGATTGAGGG + Intronic
1057603613 9:96481661-96481683 CCTTGGGCTCAGGAGGTTGAAGG + Intronic
1058845726 9:108957234-108957256 CCAGCTACTCAGGAGGTGGAAGG - Intronic
1059171135 9:112126250-112126272 TCATGTACACTGAAGGTGGAAGG + Intronic
1060673050 9:125487102-125487124 CCATGTCCACAGGAAGGTGAGGG + Intronic
1061005772 9:127927834-127927856 CCACGTGCACAGGTCGGGGAAGG - Intronic
1061183309 9:129037478-129037500 CATTGTGGAGAGGAGGTGGAGGG + Intronic
1061736592 9:132664850-132664872 GCATGTGCAAAGGAGGAGGAAGG - Intronic
1061902212 9:133678704-133678726 CCGTGTGGACAGGTGTTGGACGG - Intronic
1062611451 9:137376384-137376406 TCTGGTGAACAGGAGGTGGAAGG - Intronic
1203734884 Un_GL000216v2:127190-127212 ACTTGAGCCCAGGAGGTGGAGGG + Intergenic
1186895781 X:14003239-14003261 CCACATTCACAGGAAGTGGAAGG - Intergenic
1188354426 X:29174001-29174023 CCTTGAACCCAGGAGGTGGAGGG - Intronic
1192061066 X:67826735-67826757 CCAGCTACACAGGAGGTGGGAGG + Intergenic
1193499941 X:82263088-82263110 TCTTGTTCACAGGAGGTGGTGGG + Intergenic
1193750758 X:85340264-85340286 CTAGGGGCACAGAAGGTGGATGG + Intronic
1195683525 X:107565879-107565901 CCATGTGCACAGCAGTTGGGGGG + Intronic
1200777297 Y:7180859-7180881 TCATCTGCAGAAGAGGTGGAAGG - Intergenic
1202626150 Y:56861364-56861386 ACTTGAGCCCAGGAGGTGGAGGG - Intergenic