ID: 1132978424

View in Genome Browser
Species Human (GRCh38)
Location 16:2721586-2721608
Sequence CTGGGGGTCTGGAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132978397_1132978424 27 Left 1132978397 16:2721536-2721558 CCAGTCCCTGGAGTTCCCGGGTC No data
Right 1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG No data
1132978401_1132978424 22 Left 1132978401 16:2721541-2721563 CCCTGGAGTTCCCGGGTCGGGGG No data
Right 1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG No data
1132978407_1132978424 12 Left 1132978407 16:2721551-2721573 CCCGGGTCGGGGGTGGGAGGCGG No data
Right 1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG No data
1132978409_1132978424 11 Left 1132978409 16:2721552-2721574 CCGGGTCGGGGGTGGGAGGCGGG No data
Right 1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG No data
1132978403_1132978424 21 Left 1132978403 16:2721542-2721564 CCTGGAGTTCCCGGGTCGGGGGT No data
Right 1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132978424 Original CRISPR CTGGGGGTCTGGAGGGAAGG AGG Intergenic
No off target data available for this crispr