ID: 1132980498

View in Genome Browser
Species Human (GRCh38)
Location 16:2736629-2736651
Sequence CAGGAAGCCTTCCAGACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132980498_1132980511 27 Left 1132980498 16:2736629-2736651 CCATCAGTCTGGAAGGCTTCCTG No data
Right 1132980511 16:2736679-2736701 TCAGTGACTGGGGGGCATCCCGG No data
1132980498_1132980506 16 Left 1132980498 16:2736629-2736651 CCATCAGTCTGGAAGGCTTCCTG No data
Right 1132980506 16:2736668-2736690 GGCCAGTGAGGTCAGTGACTGGG No data
1132980498_1132980509 18 Left 1132980498 16:2736629-2736651 CCATCAGTCTGGAAGGCTTCCTG No data
Right 1132980509 16:2736670-2736692 CCAGTGAGGTCAGTGACTGGGGG No data
1132980498_1132980512 28 Left 1132980498 16:2736629-2736651 CCATCAGTCTGGAAGGCTTCCTG No data
Right 1132980512 16:2736680-2736702 CAGTGACTGGGGGGCATCCCGGG No data
1132980498_1132980505 15 Left 1132980498 16:2736629-2736651 CCATCAGTCTGGAAGGCTTCCTG No data
Right 1132980505 16:2736667-2736689 AGGCCAGTGAGGTCAGTGACTGG No data
1132980498_1132980502 -5 Left 1132980498 16:2736629-2736651 CCATCAGTCTGGAAGGCTTCCTG No data
Right 1132980502 16:2736647-2736669 TCCTGGAGGAGGCGAGACTTAGG No data
1132980498_1132980504 4 Left 1132980498 16:2736629-2736651 CCATCAGTCTGGAAGGCTTCCTG No data
Right 1132980504 16:2736656-2736678 AGGCGAGACTTAGGCCAGTGAGG No data
1132980498_1132980510 19 Left 1132980498 16:2736629-2736651 CCATCAGTCTGGAAGGCTTCCTG No data
Right 1132980510 16:2736671-2736693 CAGTGAGGTCAGTGACTGGGGGG No data
1132980498_1132980507 17 Left 1132980498 16:2736629-2736651 CCATCAGTCTGGAAGGCTTCCTG No data
Right 1132980507 16:2736669-2736691 GCCAGTGAGGTCAGTGACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132980498 Original CRISPR CAGGAAGCCTTCCAGACTGA TGG (reversed) Intergenic
No off target data available for this crispr