ID: 1132980503

View in Genome Browser
Species Human (GRCh38)
Location 16:2736648-2736670
Sequence GCCTAAGTCTCGCCTCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132980503_1132980518 27 Left 1132980503 16:2736648-2736670 CCTGGAGGAGGCGAGACTTAGGC No data
Right 1132980518 16:2736698-2736720 CCGGGAGGGCCCAGCAAGAAGGG No data
1132980503_1132980513 12 Left 1132980503 16:2736648-2736670 CCTGGAGGAGGCGAGACTTAGGC No data
Right 1132980513 16:2736683-2736705 TGACTGGGGGGCATCCCGGGAGG No data
1132980503_1132980509 -1 Left 1132980503 16:2736648-2736670 CCTGGAGGAGGCGAGACTTAGGC No data
Right 1132980509 16:2736670-2736692 CCAGTGAGGTCAGTGACTGGGGG No data
1132980503_1132980512 9 Left 1132980503 16:2736648-2736670 CCTGGAGGAGGCGAGACTTAGGC No data
Right 1132980512 16:2736680-2736702 CAGTGACTGGGGGGCATCCCGGG No data
1132980503_1132980510 0 Left 1132980503 16:2736648-2736670 CCTGGAGGAGGCGAGACTTAGGC No data
Right 1132980510 16:2736671-2736693 CAGTGAGGTCAGTGACTGGGGGG No data
1132980503_1132980516 26 Left 1132980503 16:2736648-2736670 CCTGGAGGAGGCGAGACTTAGGC No data
Right 1132980516 16:2736697-2736719 CCCGGGAGGGCCCAGCAAGAAGG No data
1132980503_1132980506 -3 Left 1132980503 16:2736648-2736670 CCTGGAGGAGGCGAGACTTAGGC No data
Right 1132980506 16:2736668-2736690 GGCCAGTGAGGTCAGTGACTGGG No data
1132980503_1132980519 28 Left 1132980503 16:2736648-2736670 CCTGGAGGAGGCGAGACTTAGGC No data
Right 1132980519 16:2736699-2736721 CGGGAGGGCCCAGCAAGAAGGGG No data
1132980503_1132980507 -2 Left 1132980503 16:2736648-2736670 CCTGGAGGAGGCGAGACTTAGGC No data
Right 1132980507 16:2736669-2736691 GCCAGTGAGGTCAGTGACTGGGG No data
1132980503_1132980511 8 Left 1132980503 16:2736648-2736670 CCTGGAGGAGGCGAGACTTAGGC No data
Right 1132980511 16:2736679-2736701 TCAGTGACTGGGGGGCATCCCGG No data
1132980503_1132980505 -4 Left 1132980503 16:2736648-2736670 CCTGGAGGAGGCGAGACTTAGGC No data
Right 1132980505 16:2736667-2736689 AGGCCAGTGAGGTCAGTGACTGG No data
1132980503_1132980514 13 Left 1132980503 16:2736648-2736670 CCTGGAGGAGGCGAGACTTAGGC No data
Right 1132980514 16:2736684-2736706 GACTGGGGGGCATCCCGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132980503 Original CRISPR GCCTAAGTCTCGCCTCCTCC AGG (reversed) Intergenic