ID: 1132980512

View in Genome Browser
Species Human (GRCh38)
Location 16:2736680-2736702
Sequence CAGTGACTGGGGGGCATCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132980503_1132980512 9 Left 1132980503 16:2736648-2736670 CCTGGAGGAGGCGAGACTTAGGC No data
Right 1132980512 16:2736680-2736702 CAGTGACTGGGGGGCATCCCGGG No data
1132980498_1132980512 28 Left 1132980498 16:2736629-2736651 CCATCAGTCTGGAAGGCTTCCTG No data
Right 1132980512 16:2736680-2736702 CAGTGACTGGGGGGCATCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132980512 Original CRISPR CAGTGACTGGGGGGCATCCC GGG Intergenic
No off target data available for this crispr