ID: 1132980555

View in Genome Browser
Species Human (GRCh38)
Location 16:2736831-2736853
Sequence GGACACTATGGGGGCCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132980555_1132980564 -2 Left 1132980555 16:2736831-2736853 CCTCAGGGGCCCCCATAGTGTCC No data
Right 1132980564 16:2736852-2736874 CCAGGCTGGTTTCCAGGCTGAGG No data
1132980555_1132980570 14 Left 1132980555 16:2736831-2736853 CCTCAGGGGCCCCCATAGTGTCC No data
Right 1132980570 16:2736868-2736890 GCTGAGGGGCTCAGGGCGTGAGG No data
1132980555_1132980573 23 Left 1132980555 16:2736831-2736853 CCTCAGGGGCCCCCATAGTGTCC No data
Right 1132980573 16:2736877-2736899 CTCAGGGCGTGAGGCCTGAGGGG No data
1132980555_1132980568 7 Left 1132980555 16:2736831-2736853 CCTCAGGGGCCCCCATAGTGTCC No data
Right 1132980568 16:2736861-2736883 TTTCCAGGCTGAGGGGCTCAGGG No data
1132980555_1132980566 0 Left 1132980555 16:2736831-2736853 CCTCAGGGGCCCCCATAGTGTCC No data
Right 1132980566 16:2736854-2736876 AGGCTGGTTTCCAGGCTGAGGGG No data
1132980555_1132980562 -8 Left 1132980555 16:2736831-2736853 CCTCAGGGGCCCCCATAGTGTCC No data
Right 1132980562 16:2736846-2736868 TAGTGTCCAGGCTGGTTTCCAGG No data
1132980555_1132980565 -1 Left 1132980555 16:2736831-2736853 CCTCAGGGGCCCCCATAGTGTCC No data
Right 1132980565 16:2736853-2736875 CAGGCTGGTTTCCAGGCTGAGGG No data
1132980555_1132980567 6 Left 1132980555 16:2736831-2736853 CCTCAGGGGCCCCCATAGTGTCC No data
Right 1132980567 16:2736860-2736882 GTTTCCAGGCTGAGGGGCTCAGG No data
1132980555_1132980571 21 Left 1132980555 16:2736831-2736853 CCTCAGGGGCCCCCATAGTGTCC No data
Right 1132980571 16:2736875-2736897 GGCTCAGGGCGTGAGGCCTGAGG No data
1132980555_1132980572 22 Left 1132980555 16:2736831-2736853 CCTCAGGGGCCCCCATAGTGTCC No data
Right 1132980572 16:2736876-2736898 GCTCAGGGCGTGAGGCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132980555 Original CRISPR GGACACTATGGGGGCCCCTG AGG (reversed) Intergenic
No off target data available for this crispr