ID: 1132980772

View in Genome Browser
Species Human (GRCh38)
Location 16:2737783-2737805
Sequence CAGTCTCAGCAGGGGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132980751_1132980772 25 Left 1132980751 16:2737735-2737757 CCCCATCCCACCAAACTCAGTGG No data
Right 1132980772 16:2737783-2737805 CAGTCTCAGCAGGGGGATGGAGG No data
1132980762_1132980772 -9 Left 1132980762 16:2737769-2737791 CCTGAGCCAATCCCCAGTCTCAG No data
Right 1132980772 16:2737783-2737805 CAGTCTCAGCAGGGGGATGGAGG No data
1132980761_1132980772 -8 Left 1132980761 16:2737768-2737790 CCCTGAGCCAATCCCCAGTCTCA No data
Right 1132980772 16:2737783-2737805 CAGTCTCAGCAGGGGGATGGAGG No data
1132980755_1132980772 23 Left 1132980755 16:2737737-2737759 CCATCCCACCAAACTCAGTGGGG No data
Right 1132980772 16:2737783-2737805 CAGTCTCAGCAGGGGGATGGAGG No data
1132980757_1132980772 19 Left 1132980757 16:2737741-2737763 CCCACCAAACTCAGTGGGGAGAA No data
Right 1132980772 16:2737783-2737805 CAGTCTCAGCAGGGGGATGGAGG No data
1132980759_1132980772 15 Left 1132980759 16:2737745-2737767 CCAAACTCAGTGGGGAGAACAGG No data
Right 1132980772 16:2737783-2737805 CAGTCTCAGCAGGGGGATGGAGG No data
1132980758_1132980772 18 Left 1132980758 16:2737742-2737764 CCACCAAACTCAGTGGGGAGAAC No data
Right 1132980772 16:2737783-2737805 CAGTCTCAGCAGGGGGATGGAGG No data
1132980753_1132980772 24 Left 1132980753 16:2737736-2737758 CCCATCCCACCAAACTCAGTGGG No data
Right 1132980772 16:2737783-2737805 CAGTCTCAGCAGGGGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132980772 Original CRISPR CAGTCTCAGCAGGGGGATGG AGG Intergenic
No off target data available for this crispr