ID: 1132981174

View in Genome Browser
Species Human (GRCh38)
Location 16:2739348-2739370
Sequence CAGGCACAGCTCAGCCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132981166_1132981174 24 Left 1132981166 16:2739301-2739323 CCCTGGGGCCCCTGAGGACAGGT No data
Right 1132981174 16:2739348-2739370 CAGGCACAGCTCAGCCACACTGG No data
1132981167_1132981174 23 Left 1132981167 16:2739302-2739324 CCTGGGGCCCCTGAGGACAGGTC No data
Right 1132981174 16:2739348-2739370 CAGGCACAGCTCAGCCACACTGG No data
1132981169_1132981174 15 Left 1132981169 16:2739310-2739332 CCCTGAGGACAGGTCCTCTGAGT No data
Right 1132981174 16:2739348-2739370 CAGGCACAGCTCAGCCACACTGG No data
1132981168_1132981174 16 Left 1132981168 16:2739309-2739331 CCCCTGAGGACAGGTCCTCTGAG No data
Right 1132981174 16:2739348-2739370 CAGGCACAGCTCAGCCACACTGG No data
1132981171_1132981174 1 Left 1132981171 16:2739324-2739346 CCTCTGAGTGTCTGCATGTCCTC No data
Right 1132981174 16:2739348-2739370 CAGGCACAGCTCAGCCACACTGG No data
1132981170_1132981174 14 Left 1132981170 16:2739311-2739333 CCTGAGGACAGGTCCTCTGAGTG No data
Right 1132981174 16:2739348-2739370 CAGGCACAGCTCAGCCACACTGG No data
1132981163_1132981174 30 Left 1132981163 16:2739295-2739317 CCTTCACCCTGGGGCCCCTGAGG No data
Right 1132981174 16:2739348-2739370 CAGGCACAGCTCAGCCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132981174 Original CRISPR CAGGCACAGCTCAGCCACAC TGG Intergenic
No off target data available for this crispr