ID: 1132981912

View in Genome Browser
Species Human (GRCh38)
Location 16:2742632-2742654
Sequence CACCAGCAGGTCCCTGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132981912_1132981925 29 Left 1132981912 16:2742632-2742654 CCCTTTGCAGGGACCTGCTGGTG No data
Right 1132981925 16:2742684-2742706 GTTCTGTCTCCCAGAGGCCTTGG No data
1132981912_1132981924 23 Left 1132981912 16:2742632-2742654 CCCTTTGCAGGGACCTGCTGGTG No data
Right 1132981924 16:2742678-2742700 CTCTGAGTTCTGTCTCCCAGAGG No data
1132981912_1132981919 -9 Left 1132981912 16:2742632-2742654 CCCTTTGCAGGGACCTGCTGGTG No data
Right 1132981919 16:2742646-2742668 CTGCTGGTGGCCTCTGGGCAGGG No data
1132981912_1132981918 -10 Left 1132981912 16:2742632-2742654 CCCTTTGCAGGGACCTGCTGGTG No data
Right 1132981918 16:2742645-2742667 CCTGCTGGTGGCCTCTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132981912 Original CRISPR CACCAGCAGGTCCCTGCAAA GGG (reversed) Intergenic
No off target data available for this crispr