ID: 1132982621

View in Genome Browser
Species Human (GRCh38)
Location 16:2746279-2746301
Sequence CTGCATTCTCCTGGTGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132982621_1132982623 0 Left 1132982621 16:2746279-2746301 CCTTGAGCACCAGGAGAATGCAG No data
Right 1132982623 16:2746302-2746324 AGCTCCATTTTTTTTTTTTTTGG No data
1132982621_1132982625 27 Left 1132982621 16:2746279-2746301 CCTTGAGCACCAGGAGAATGCAG No data
Right 1132982625 16:2746329-2746351 AGAGTCTCACTCTGTCGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132982621 Original CRISPR CTGCATTCTCCTGGTGCTCA AGG (reversed) Intergenic