ID: 1132982623

View in Genome Browser
Species Human (GRCh38)
Location 16:2746302-2746324
Sequence AGCTCCATTTTTTTTTTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132982622_1132982623 -9 Left 1132982622 16:2746288-2746310 CCAGGAGAATGCAGAGCTCCATT No data
Right 1132982623 16:2746302-2746324 AGCTCCATTTTTTTTTTTTTTGG No data
1132982619_1132982623 16 Left 1132982619 16:2746263-2746285 CCTGACATGGTTGGTGCCTTGAG No data
Right 1132982623 16:2746302-2746324 AGCTCCATTTTTTTTTTTTTTGG No data
1132982621_1132982623 0 Left 1132982621 16:2746279-2746301 CCTTGAGCACCAGGAGAATGCAG No data
Right 1132982623 16:2746302-2746324 AGCTCCATTTTTTTTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132982623 Original CRISPR AGCTCCATTTTTTTTTTTTT TGG Intergenic