ID: 1132983079

View in Genome Browser
Species Human (GRCh38)
Location 16:2749236-2749258
Sequence TGCAAGCAGGGTCTCTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132983079_1132983088 0 Left 1132983079 16:2749236-2749258 CCTCTCAAGAGACCCTGCTTGCA No data
Right 1132983088 16:2749259-2749281 GCCCTGTGGGAGGGGTTGGATGG No data
1132983079_1132983095 8 Left 1132983079 16:2749236-2749258 CCTCTCAAGAGACCCTGCTTGCA No data
Right 1132983095 16:2749267-2749289 GGAGGGGTTGGATGGGGGCTGGG No data
1132983079_1132983097 25 Left 1132983079 16:2749236-2749258 CCTCTCAAGAGACCCTGCTTGCA No data
Right 1132983097 16:2749284-2749306 GCTGGGGTCTCCAGATAAAAAGG No data
1132983079_1132983084 -10 Left 1132983079 16:2749236-2749258 CCTCTCAAGAGACCCTGCTTGCA No data
Right 1132983084 16:2749249-2749271 CCTGCTTGCAGCCCTGTGGGAGG No data
1132983079_1132983092 2 Left 1132983079 16:2749236-2749258 CCTCTCAAGAGACCCTGCTTGCA No data
Right 1132983092 16:2749261-2749283 CCTGTGGGAGGGGTTGGATGGGG No data
1132983079_1132983085 -9 Left 1132983079 16:2749236-2749258 CCTCTCAAGAGACCCTGCTTGCA No data
Right 1132983085 16:2749250-2749272 CTGCTTGCAGCCCTGTGGGAGGG No data
1132983079_1132983093 3 Left 1132983079 16:2749236-2749258 CCTCTCAAGAGACCCTGCTTGCA No data
Right 1132983093 16:2749262-2749284 CTGTGGGAGGGGTTGGATGGGGG No data
1132983079_1132983096 9 Left 1132983079 16:2749236-2749258 CCTCTCAAGAGACCCTGCTTGCA No data
Right 1132983096 16:2749268-2749290 GAGGGGTTGGATGGGGGCTGGGG No data
1132983079_1132983086 -8 Left 1132983079 16:2749236-2749258 CCTCTCAAGAGACCCTGCTTGCA No data
Right 1132983086 16:2749251-2749273 TGCTTGCAGCCCTGTGGGAGGGG No data
1132983079_1132983087 -4 Left 1132983079 16:2749236-2749258 CCTCTCAAGAGACCCTGCTTGCA No data
Right 1132983087 16:2749255-2749277 TGCAGCCCTGTGGGAGGGGTTGG No data
1132983079_1132983094 7 Left 1132983079 16:2749236-2749258 CCTCTCAAGAGACCCTGCTTGCA No data
Right 1132983094 16:2749266-2749288 GGGAGGGGTTGGATGGGGGCTGG No data
1132983079_1132983090 1 Left 1132983079 16:2749236-2749258 CCTCTCAAGAGACCCTGCTTGCA No data
Right 1132983090 16:2749260-2749282 CCCTGTGGGAGGGGTTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132983079 Original CRISPR TGCAAGCAGGGTCTCTTGAG AGG (reversed) Intergenic
No off target data available for this crispr