ID: 1132984921

View in Genome Browser
Species Human (GRCh38)
Location 16:2760404-2760426
Sequence CGTTGTGTGCTGGTAGTACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132984921_1132984924 -9 Left 1132984921 16:2760404-2760426 CCAGGTACTACCAGCACACAACG 0: 1
1: 0
2: 1
3: 5
4: 55
Right 1132984924 16:2760418-2760440 CACACAACGGCCTAGTAGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132984921 Original CRISPR CGTTGTGTGCTGGTAGTACC TGG (reversed) Exonic
904524507 1:31122619-31122641 TGTTGTGTGCTTGTAGTCCCAGG + Intergenic
905408061 1:37750710-37750732 TGATGTGTGCCTGTAGTACCAGG - Intronic
909339652 1:74517436-74517458 GGTACTGTGCTGGTGGTACCAGG + Intronic
915203952 1:154255298-154255320 TGTTGTGTGGTGGTAGTATTTGG - Exonic
1064203967 10:13307095-13307117 CGTGGTGTGCCTGTAGTCCCAGG + Intergenic
1073043461 10:100622533-100622555 CTTTGTGTGCTGGGAGTGTCAGG + Intergenic
1073782584 10:106855984-106856006 AGTTGTGTGATGGTAATACGGGG + Intronic
1088391495 11:109319781-109319803 CGTGGTGTGACTGTAGTACCTGG + Intergenic
1089489817 11:118875632-118875654 GGTTGTGTGCTGGTTGTATGAGG + Intergenic
1089489827 11:118875758-118875780 TGTTGTGTGCTGGTTGTATGAGG + Intergenic
1089489835 11:118875840-118875862 GGTTGTGTGCTGGTTGTATGAGG + Intergenic
1089489840 11:118875884-118875906 GGTTGTGTGCTGGTTGTATGAGG + Intergenic
1089489844 11:118875925-118875947 GGTTGTGTGCTGGTTGTATGAGG + Intergenic
1089489848 11:118875966-118875988 GGTTGTGTGCTGGTTGTATGAGG + Intergenic
1095519700 12:43048630-43048652 CATTTTGTTCTGGTAATACCAGG + Intergenic
1096752382 12:53769310-53769332 CGGTGTGTGCTGGTAGCATCTGG + Intergenic
1097394623 12:59058755-59058777 CTTTGTGTTTTGCTAGTACCAGG + Intergenic
1102838167 12:116087579-116087601 CGTAGTGTGCTGTTAGTAAATGG - Intronic
1105914281 13:24898026-24898048 CGTGGTGTGCCTGTAGTCCCAGG - Intronic
1106398094 13:29401118-29401140 CGGTGTGTGCCCGTAGTCCCAGG - Intronic
1115147982 14:30248631-30248653 GGTTGTGTTCTGGAATTACCTGG - Intergenic
1116892633 14:50283349-50283371 GGTCTTGTGCTGGTAGAACCAGG - Intronic
1121820774 14:96964319-96964341 GGCTGTGTGCTGGGAGGACCTGG + Intergenic
1125135176 15:36332989-36333011 AGTTGTGGGCTGTTAGTAACTGG + Intergenic
1126637911 15:50797177-50797199 CGTTGTGGGCCTGTAGTCCCAGG + Intergenic
1129532913 15:76283322-76283344 TGGTGTGTGCTTGTAGTCCCAGG - Intronic
1130433516 15:83873509-83873531 GGTTGTGTGCCTGTAGTTCCAGG - Intronic
1132984921 16:2760404-2760426 CGTTGTGTGCTGGTAGTACCTGG - Exonic
1138878214 16:60979108-60979130 CGGTGTGTGATGGCAGTAGCTGG - Intergenic
1145237410 17:21218231-21218253 AGTTGTGTGTCAGTAGTACCAGG - Intergenic
1147469494 17:40646634-40646656 TGTTGTGAGCTGGTAATACTAGG - Intronic
1155229110 18:23756743-23756765 TGAAGTGTGCTGGTAGCACCAGG - Intronic
934647130 2:96065513-96065535 CTTTCTGTGCTGGCAGTCCCTGG + Intergenic
1170731485 20:18979507-18979529 CGTGGTGTGCCAGTAGTTCCTGG + Intergenic
1173414072 20:42840153-42840175 CGTGGTTTGCTGGTAATCCCTGG + Intronic
1176256519 20:64155920-64155942 CGTTCTGTGCTGGTAGGACCAGG + Intronic
1177090028 21:16756229-16756251 CGTTGTGTGCTGAAGGTAGCAGG + Intergenic
1181672516 22:24432367-24432389 AGGTGGGTGCTGGTAGTTCCTGG + Exonic
1183235980 22:36618076-36618098 AGTTGTGTGCTGGTGACACCAGG + Intronic
1183343306 22:37293968-37293990 CGTGGTGTCCCCGTAGTACCTGG + Intronic
1184253079 22:43271892-43271914 CGGTGAGTGCTGGTTGTACCTGG - Intronic
950380009 3:12604757-12604779 CTTTGTTTGCTGGTTGTAGCAGG - Intronic
955466663 3:59243978-59244000 CCTTCTGTGCTGGGAGTTCCTGG + Intergenic
961020874 3:123505919-123505941 AGTTGTGTGCTTGTAGGCCCTGG + Intronic
966432119 3:179843294-179843316 AGTTGGGTCCTGGTTGTACCCGG - Intronic
967469546 3:189845989-189846011 AGGTGTGTGCTGATATTACCTGG + Intronic
972800416 4:42469373-42469395 CATAGTGTGCTGTGAGTACCTGG + Intronic
977971456 4:103218364-103218386 TGTGGTGTGCTGGAGGTACCAGG - Intergenic
982436999 4:155391201-155391223 TGATGTGTGCTTGTAGTACCAGG + Intergenic
986982746 5:13468262-13468284 CGCTCTATGTTGGTAGTACCTGG + Intergenic
987358435 5:17084971-17084993 CGGTGTGCACTTGTAGTACCAGG - Intronic
1004525041 6:16399701-16399723 CGCTGGATGCTGGTAGCACCCGG - Intronic
1017044789 6:150337356-150337378 GGCTGTGAGCTGGTAGGACCTGG + Intergenic
1019460067 7:1153374-1153396 CGGTGTGTGCCTGTAGTACCAGG - Intronic
1023381444 7:39612301-39612323 CGGTGTGTGCCCGTAGTTCCAGG + Intergenic
1023756648 7:43424488-43424510 TGTTGTGTGCCTGTAGTTCCAGG + Intronic
1026555958 7:71408738-71408760 TGGTGTGTGCAGGTAGTTCCAGG + Intronic
1049108817 8:140630029-140630051 CGTTGTGAGCTGGGAGAAGCAGG - Intronic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1195325064 X:103751849-103751871 CTTTGTGGCCTGGTAGGACCAGG - Intergenic
1196193662 X:112818804-112818826 TGCTGTGTGCTGGAAGGACCTGG - Intronic
1197863467 X:130994724-130994746 CCTAGTGTGCTTGTAGTCCCAGG - Intergenic