ID: 1132985610

View in Genome Browser
Species Human (GRCh38)
Location 16:2765681-2765703
Sequence CTAGAACTCCCCCAAGGCAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132985602_1132985610 28 Left 1132985602 16:2765630-2765652 CCAGACTGTCCCGTAGAAGCCGC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1132985610 16:2765681-2765703 CTAGAACTCCCCCAAGGCACCGG 0: 1
1: 0
2: 0
3: 8
4: 131
1132985603_1132985610 19 Left 1132985603 16:2765639-2765661 CCCGTAGAAGCCGCTCTGCCTCA 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1132985610 16:2765681-2765703 CTAGAACTCCCCCAAGGCACCGG 0: 1
1: 0
2: 0
3: 8
4: 131
1132985604_1132985610 18 Left 1132985604 16:2765640-2765662 CCGTAGAAGCCGCTCTGCCTCAT 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1132985610 16:2765681-2765703 CTAGAACTCCCCCAAGGCACCGG 0: 1
1: 0
2: 0
3: 8
4: 131
1132985607_1132985610 -5 Left 1132985607 16:2765663-2765685 CCTCACCAGAAACTCGCTCTAGA 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1132985610 16:2765681-2765703 CTAGAACTCCCCCAAGGCACCGG 0: 1
1: 0
2: 0
3: 8
4: 131
1132985605_1132985610 9 Left 1132985605 16:2765649-2765671 CCGCTCTGCCTCATCCTCACCAG 0: 1
1: 0
2: 8
3: 122
4: 1183
Right 1132985610 16:2765681-2765703 CTAGAACTCCCCCAAGGCACCGG 0: 1
1: 0
2: 0
3: 8
4: 131
1132985608_1132985610 -10 Left 1132985608 16:2765668-2765690 CCAGAAACTCGCTCTAGAACTCC 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1132985610 16:2765681-2765703 CTAGAACTCCCCCAAGGCACCGG 0: 1
1: 0
2: 0
3: 8
4: 131
1132985606_1132985610 1 Left 1132985606 16:2765657-2765679 CCTCATCCTCACCAGAAACTCGC 0: 1
1: 0
2: 3
3: 25
4: 262
Right 1132985610 16:2765681-2765703 CTAGAACTCCCCCAAGGCACCGG 0: 1
1: 0
2: 0
3: 8
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132985610 Original CRISPR CTAGAACTCCCCCAAGGCAC CGG Exonic
900680829 1:3915314-3915336 CTGGGACTCCCCCAAAGCTCTGG + Intergenic
900914541 1:5626644-5626666 CTAGAACTCTCATACGGCACTGG + Intergenic
902294854 1:15460150-15460172 ACAGAATTCCCCAAAGGCACTGG + Intronic
903764241 1:25723397-25723419 CTAGAAAACCCCAAAGGCTCTGG - Intronic
904031502 1:27536266-27536288 CCAGGACTCCCCCAAGGTCCAGG + Intronic
904268838 1:29335149-29335171 CTAGTAATCCCCCAAAGGACTGG - Intergenic
905502032 1:38447062-38447084 CTAGACATCCTACAAGGCACAGG - Intergenic
909938903 1:81588141-81588163 CTAGAGCTCCCCAAAGGAGCAGG - Intronic
911018792 1:93365393-93365415 CTAGAAATCCTACAATGCACAGG - Exonic
912409521 1:109470573-109470595 CTAGAACTCCCCCTTGTCTCAGG + Intronic
915453202 1:156020991-156021013 CTACAACTCCCACAAGGCATTGG - Intergenic
916791012 1:168125275-168125297 TCAGCACTCCCCAAAGGCACAGG - Intronic
919922533 1:202174917-202174939 CTGGGACTCCCCCAGGGCCCTGG + Intergenic
920312753 1:205058256-205058278 CATGAACCCCACCAAGGCACAGG + Exonic
1062959438 10:1561715-1561737 CTAGAACTCCCCCCAGGTGGAGG + Intronic
1063202772 10:3801044-3801066 CAAGTACTCTTCCAAGGCACTGG - Intergenic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1072252928 10:93595857-93595879 CTGGAACAGCCTCAAGGCACAGG - Intronic
1072638823 10:97195914-97195936 CGACAACTCCTCCAAGGCTCCGG - Intronic
1076795090 10:132794456-132794478 CTGGAACTCACCCAAGACCCGGG - Intergenic
1077410284 11:2400654-2400676 CTACAGCTCCCACAAGGAACTGG - Exonic
1078755180 11:14202340-14202362 TAAAAACTCCACCAAGGCACAGG - Intronic
1088660411 11:112039823-112039845 CTAGAGCTCCCTGAAGGCAAGGG + Intronic
1089811471 11:121135315-121135337 ATAGAACTTCCCCTAGGCCCCGG - Intronic
1090920951 11:131205420-131205442 CTAAACATCCACCAAGGCACAGG - Intergenic
1096796001 12:54077915-54077937 CTACATCCCCGCCAAGGCACAGG + Intergenic
1097067830 12:56333774-56333796 CTAGAATTCTCCCACGGCAGCGG + Intronic
1101119383 12:101563475-101563497 CTAGGACTCACCAAAGTCACTGG + Intergenic
1102412861 12:112735477-112735499 CTAGAAATGCCCCAGGGCAGAGG + Intronic
1102478056 12:113201611-113201633 CTAGAATCCACCCAAGGCAGGGG - Intronic
1102721063 12:115016642-115016664 GAAGAACTCCCCCAAGTCCCAGG + Intergenic
1104643927 12:130484002-130484024 CCAGAAGTTCCCCCAGGCACTGG + Intronic
1107282176 13:38749609-38749631 CTACAGATCCCACAAGGCACAGG - Intronic
1114568605 14:23650047-23650069 CTAGAATTCCCCCATAGCCCTGG - Intergenic
1115352285 14:32408179-32408201 CAAGAACTCCTCCAAGACTCTGG + Intronic
1115367432 14:32574115-32574137 CTAGATCTCCCTAAAGGGACGGG + Intronic
1118124490 14:62885664-62885686 CTCGAACTCCCTGAAGGCACTGG - Intronic
1120812590 14:88819471-88819493 CAAGAACTTCCTCAAGGAACTGG + Intergenic
1122307384 14:100774293-100774315 CTAGAACACCTCACAGGCACGGG - Intergenic
1122417743 14:101558348-101558370 CTGGCACTCCCCTAAGTCACAGG + Intergenic
1122551189 14:102550906-102550928 CTGGCACTCCCCAAGGGCACAGG + Intergenic
1122711503 14:103661824-103661846 CTAGACCTCCCTCAAAGCGCGGG + Intronic
1202942395 14_KI270725v1_random:164409-164431 CTAGAAATCTCCCTAGGCATTGG + Intergenic
1126196669 15:45938964-45938986 CTAGAACTTCCCCAGGGGTCAGG + Intergenic
1128286608 15:66442255-66442277 CCAGAACCCCACCAAGGAACCGG - Intronic
1128483824 15:68065336-68065358 CTAGGTCTCCCCCAAAGCACTGG - Intronic
1128997543 15:72307750-72307772 CTTGCACTCCCCCGAGGCCCTGG - Intronic
1132299044 15:100765259-100765281 TGAGAGCTCCCCCAAGGCAGTGG - Intergenic
1132985610 16:2765681-2765703 CTAGAACTCCCCCAAGGCACCGG + Exonic
1134026523 16:10958236-10958258 CAGGGACTCCCCCAGGGCACAGG - Intronic
1140455408 16:75102536-75102558 CCAGAAGTCCTCCAAGCCACAGG - Intronic
1141487971 16:84353791-84353813 CAAGAACTCCCAGAAGTCACAGG + Intergenic
1143259600 17:5588232-5588254 CAAGAACTTCCCCAAGGTTCAGG + Intronic
1145269364 17:21396527-21396549 CTAGAACCCCGGCCAGGCACGGG - Intronic
1147838343 17:43351317-43351339 CTCTAACTCCCCCAAGGAAAGGG + Intergenic
1148861831 17:50608605-50608627 CCAGAACTTCCCCAAGCCAAGGG - Intronic
1152856724 17:82668767-82668789 CTAGAGCTGCCCCAGGGCAGCGG + Intronic
1152998562 18:431703-431725 CTGGCACTCCTCCTAGGCACTGG - Intronic
1154085663 18:11303072-11303094 CAAGAACTCCCCAGGGGCACAGG - Intergenic
1156553135 18:38039634-38039656 CCAGGGCTCCCACAAGGCACTGG - Intergenic
1162089409 19:8269155-8269177 CTCTAACTCCCCCAAGGAAAGGG - Intronic
1163081910 19:14950242-14950264 CTACAAGTCCCTCATGGCACAGG - Exonic
1167310507 19:48735105-48735127 CTACAACTCCCAGAAGGCCCGGG - Intronic
1167312512 19:48745411-48745433 CTACAACTCCCAGAAGGCAACGG - Intronic
1167318569 19:48781235-48781257 CTCTAACTCCCCCAAGGAAGGGG + Intergenic
1168096034 19:54115390-54115412 CTACAACTCCCACAAGGCCTAGG - Exonic
927094273 2:19735777-19735799 CTGGAACTTCCCCAAATCACTGG + Intergenic
927623156 2:24683640-24683662 CCAGCCCTGCCCCAAGGCACAGG - Intronic
931412790 2:62049516-62049538 CTAAACCTCCCCTAATGCACAGG + Intronic
936071975 2:109377084-109377106 CTAGACCTCCCCCCAGGGAAAGG - Intronic
936144404 2:109970156-109970178 CTCTAACTCCCCCAAGGAAAGGG - Intergenic
936181087 2:110268116-110268138 CTCTAACTCCCCCAAGGAAAGGG - Intergenic
936200284 2:110401313-110401335 CTCTAACTCCCCCAAGGAAAGGG + Intergenic
936623295 2:114122283-114122305 CTAGATTTCCCCAGAGGCACCGG - Intergenic
940254442 2:151714135-151714157 CTCCAACTCTCCCAAAGCACAGG + Intronic
940415369 2:153413235-153413257 CCAAAACTCCCCAAGGGCACAGG + Intergenic
941025789 2:160454682-160454704 CTAGAACTCCTCTAAGGAGCTGG + Intronic
947588192 2:231370013-231370035 CTGGAACCCACCCAAGGCAAAGG + Intronic
948321619 2:237074184-237074206 CGAGAACACCACCAAGGCAATGG - Intergenic
1170171968 20:13424760-13424782 CTAGAAGTCCCACAAAGCCCTGG - Intronic
1173562546 20:44016537-44016559 CTAGACATCCTACAAGGCACAGG - Intronic
1175797742 20:61783448-61783470 CGAGAACTGTCCCAAGGAACTGG - Intronic
1175797864 20:61784012-61784034 CGAGAACTGTCCCAAGGAACTGG - Intronic
1175797919 20:61784262-61784284 CGAGAACTGTCCCAAGGAACTGG - Intronic
1176580774 21:8522518-8522540 CTAGAAATCTCCCTAGGCATTGG - Intergenic
1179838378 21:44053081-44053103 CTGGAACTCACCCAAGGCCTGGG + Intronic
950678576 3:14569425-14569447 CTGGGACTCCCCCAAGGCAGGGG - Intergenic
952259443 3:31725740-31725762 CTGGAACTCCCGGAAGCCACAGG + Intronic
953867914 3:46600098-46600120 CTAGGACCCCTCCATGGCACAGG + Intronic
956629270 3:71298759-71298781 CTAGAACCCCCCCAAGCCCCAGG + Intronic
958882517 3:99688879-99688901 CTAAAACTCTCACAATGCACAGG - Intronic
959082487 3:101816806-101816828 CTAGAACTATCTCAAGGCTCAGG + Exonic
959117928 3:102199169-102199191 CTAGTACTCCCACCAGTCACTGG - Intronic
968903136 4:3440444-3440466 CTAGAACAGCCCCAGGGGACTGG - Intergenic
974328926 4:60451119-60451141 CTAGAACCCCTGCAAGCCACTGG - Intergenic
977550236 4:98434554-98434576 TCAGAACTCCCCCAAAGCAGAGG + Intronic
977837616 4:101663548-101663570 CTAGACATCCTACAAGGCACAGG - Intronic
979406229 4:120313906-120313928 ACAGAACTCCCCCAAGTCACAGG + Intergenic
981580658 4:146245639-146245661 CTAGAGATGCCCAAAGGCACAGG - Intergenic
982339870 4:154285470-154285492 CTTGAACTGCCCCAAGGCAGAGG + Intronic
983136353 4:164087068-164087090 TGGCAACTCCCCCAAGGCACTGG - Intronic
984702749 4:182828623-182828645 CCAGAACACACGCAAGGCACCGG - Intergenic
985333456 4:188866800-188866822 CTGGAACTCCCCACAGGCTCTGG - Intergenic
985629713 5:1008319-1008341 CTCCAACACCCTCAAGGCACAGG + Intergenic
997883199 5:137608924-137608946 CTAGTATTCTCCCAAGCCACAGG - Intergenic
1001366977 5:171151940-171151962 GATGAACTCCCCCAAGGAACTGG + Intronic
1003758980 6:9153417-9153439 CTAAAAGTCCCCCAAAGCATTGG + Intergenic
1004540684 6:16546986-16547008 CTAGAACTTCCCCAAGGGGAGGG - Intronic
1008539887 6:52537419-52537441 CTAAAACTCCCCAAAGGAAGTGG - Intronic
1011040020 6:83019761-83019783 GTAGAACTCCCCCATGGATCAGG - Intronic
1014412035 6:121136512-121136534 CTAAAAATCCCACAATGCACAGG + Intronic
1017826566 6:158086219-158086241 CTAGGGCTCCCCCAAAGCATGGG - Intronic
1020198530 7:6060989-6061011 CTAGAACATCAGCAAGGCACAGG - Intergenic
1022506747 7:30912307-30912329 CTAGAACCCCCCCAAGCCCAGGG - Intronic
1025020152 7:55474250-55474272 ATAGAACACACCCAAGGCAGCGG - Intronic
1028960871 7:96748894-96748916 CTAAACCTCCCTCAATGCACAGG - Intergenic
1031831145 7:126627329-126627351 CTAAACATCCCACAAGGCACAGG + Intronic
1034295643 7:149969923-149969945 CTTGAAATCCCCCAAGGAGCTGG + Intergenic
1034810418 7:154126982-154127004 CTTGAAATCCCCCAAGGAGCTGG - Intronic
1037433558 8:18839787-18839809 CTATAACTCTCCCATGACACAGG + Intronic
1039426753 8:37492801-37492823 AAGGAACTCCCCCAAGTCACAGG + Intergenic
1040111176 8:43567802-43567824 CAAGAAGTCCCCCAGGGCAATGG - Intergenic
1040111656 8:43569473-43569495 CAAGAAGTCCCCCAGGGCACGGG - Intergenic
1040112380 8:43572211-43572233 CAAGAAGTCCCCCAGGGAACGGG - Intergenic
1040860909 8:51998720-51998742 CTCGAACGACCTCAAGGCACTGG - Intergenic
1043879854 8:85529836-85529858 CTAGAGCTACTCCAAGGTACTGG - Intergenic
1044929535 8:97238649-97238671 TTAGGGCTCCCCCAGGGCACAGG - Intergenic
1046542418 8:115603753-115603775 CTATAACTTCCCCAAGTCATTGG + Intronic
1051190052 9:14501827-14501849 CTCCAACTCCTCCAAGGCAGGGG - Intergenic
1052744413 9:32426065-32426087 GTACAACTCCGCCAAGGCCCTGG - Intronic
1054159416 9:61663586-61663608 CTACAACCCCACCAGGGCACAGG - Intergenic
1054479188 9:65594591-65594613 CTACAACCCCACCAGGGCACAGG - Intergenic
1055811931 9:80159042-80159064 CTAAAGCTCCCCAAAGGCTCAGG - Intergenic
1186397527 X:9224871-9224893 CTAGACATCCCGCAATGCACAGG - Intergenic
1186898833 X:14031991-14032013 CTAAAACTCCTACAATGCACAGG - Intergenic
1189282031 X:39825747-39825769 CTAGAACTTCCCCATGGACCTGG + Intergenic
1189639901 X:43057155-43057177 CTCAAATGCCCCCAAGGCACAGG - Intergenic
1190660863 X:52653284-52653306 CCAGATCTCCCCCAAGACCCTGG + Intronic
1191848899 X:65571048-65571070 GTAGAACTCCACCATGGCCCTGG - Intergenic
1196482709 X:116168430-116168452 CTTGAACACCCACAAGGAACAGG - Intergenic