ID: 1132987719

View in Genome Browser
Species Human (GRCh38)
Location 16:2776805-2776827
Sequence CGCGGGGATCTCCGGTCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 38}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132987719_1132987731 27 Left 1132987719 16:2776805-2776827 CCCCCGGACCGGAGATCCCCGCG 0: 1
1: 0
2: 1
3: 0
4: 38
Right 1132987731 16:2776855-2776877 CAACGGATGTCCCAGTCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 48
1132987719_1132987728 10 Left 1132987719 16:2776805-2776827 CCCCCGGACCGGAGATCCCCGCG 0: 1
1: 0
2: 1
3: 0
4: 38
Right 1132987728 16:2776838-2776860 CTCGCGCTTCACCCGCACAACGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132987719 Original CRISPR CGCGGGGATCTCCGGTCCGG GGG (reversed) Intronic