ID: 1132987722

View in Genome Browser
Species Human (GRCh38)
Location 16:2776807-2776829
Sequence GCCGCGGGGATCTCCGGTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132987722_1132987732 30 Left 1132987722 16:2776807-2776829 CCCGGACCGGAGATCCCCGCGGC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1132987732 16:2776860-2776882 GATGTCCCAGTCCCGCGGCTCGG 0: 1
1: 0
2: 0
3: 5
4: 55
1132987722_1132987731 25 Left 1132987722 16:2776807-2776829 CCCGGACCGGAGATCCCCGCGGC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1132987731 16:2776855-2776877 CAACGGATGTCCCAGTCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 48
1132987722_1132987728 8 Left 1132987722 16:2776807-2776829 CCCGGACCGGAGATCCCCGCGGC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1132987728 16:2776838-2776860 CTCGCGCTTCACCCGCACAACGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132987722 Original CRISPR GCCGCGGGGATCTCCGGTCC GGG (reversed) Intronic