ID: 1132987723

View in Genome Browser
Species Human (GRCh38)
Location 16:2776808-2776830
Sequence CGCCGCGGGGATCTCCGGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132987723_1132987732 29 Left 1132987723 16:2776808-2776830 CCGGACCGGAGATCCCCGCGGCG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1132987732 16:2776860-2776882 GATGTCCCAGTCCCGCGGCTCGG 0: 1
1: 0
2: 0
3: 5
4: 55
1132987723_1132987733 30 Left 1132987723 16:2776808-2776830 CCGGACCGGAGATCCCCGCGGCG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1132987733 16:2776861-2776883 ATGTCCCAGTCCCGCGGCTCGGG 0: 1
1: 0
2: 1
3: 5
4: 71
1132987723_1132987728 7 Left 1132987723 16:2776808-2776830 CCGGACCGGAGATCCCCGCGGCG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1132987728 16:2776838-2776860 CTCGCGCTTCACCCGCACAACGG 0: 1
1: 0
2: 0
3: 1
4: 25
1132987723_1132987731 24 Left 1132987723 16:2776808-2776830 CCGGACCGGAGATCCCCGCGGCG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1132987731 16:2776855-2776877 CAACGGATGTCCCAGTCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132987723 Original CRISPR CGCCGCGGGGATCTCCGGTC CGG (reversed) Intronic