ID: 1132987724

View in Genome Browser
Species Human (GRCh38)
Location 16:2776813-2776835
Sequence GCGCTCGCCGCGGGGATCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 49}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132987724_1132987731 19 Left 1132987724 16:2776813-2776835 CCGGAGATCCCCGCGGCGAGCGC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1132987731 16:2776855-2776877 CAACGGATGTCCCAGTCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 48
1132987724_1132987728 2 Left 1132987724 16:2776813-2776835 CCGGAGATCCCCGCGGCGAGCGC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1132987728 16:2776838-2776860 CTCGCGCTTCACCCGCACAACGG 0: 1
1: 0
2: 0
3: 1
4: 25
1132987724_1132987732 24 Left 1132987724 16:2776813-2776835 CCGGAGATCCCCGCGGCGAGCGC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1132987732 16:2776860-2776882 GATGTCCCAGTCCCGCGGCTCGG 0: 1
1: 0
2: 0
3: 5
4: 55
1132987724_1132987733 25 Left 1132987724 16:2776813-2776835 CCGGAGATCCCCGCGGCGAGCGC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1132987733 16:2776861-2776883 ATGTCCCAGTCCCGCGGCTCGGG 0: 1
1: 0
2: 1
3: 5
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132987724 Original CRISPR GCGCTCGCCGCGGGGATCTC CGG (reversed) Intronic