ID: 1132987725

View in Genome Browser
Species Human (GRCh38)
Location 16:2776821-2776843
Sequence CGCGAGCTGCGCTCGCCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132987725_1132987731 11 Left 1132987725 16:2776821-2776843 CCCCGCGGCGAGCGCAGCTCGCG 0: 1
1: 0
2: 1
3: 10
4: 80
Right 1132987731 16:2776855-2776877 CAACGGATGTCCCAGTCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 48
1132987725_1132987732 16 Left 1132987725 16:2776821-2776843 CCCCGCGGCGAGCGCAGCTCGCG 0: 1
1: 0
2: 1
3: 10
4: 80
Right 1132987732 16:2776860-2776882 GATGTCCCAGTCCCGCGGCTCGG 0: 1
1: 0
2: 0
3: 5
4: 55
1132987725_1132987733 17 Left 1132987725 16:2776821-2776843 CCCCGCGGCGAGCGCAGCTCGCG 0: 1
1: 0
2: 1
3: 10
4: 80
Right 1132987733 16:2776861-2776883 ATGTCCCAGTCCCGCGGCTCGGG 0: 1
1: 0
2: 1
3: 5
4: 71
1132987725_1132987737 27 Left 1132987725 16:2776821-2776843 CCCCGCGGCGAGCGCAGCTCGCG 0: 1
1: 0
2: 1
3: 10
4: 80
Right 1132987737 16:2776871-2776893 CCCGCGGCTCGGGCGCCCGCAGG 0: 1
1: 0
2: 3
3: 26
4: 238
1132987725_1132987728 -6 Left 1132987725 16:2776821-2776843 CCCCGCGGCGAGCGCAGCTCGCG 0: 1
1: 0
2: 1
3: 10
4: 80
Right 1132987728 16:2776838-2776860 CTCGCGCTTCACCCGCACAACGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132987725 Original CRISPR CGCGAGCTGCGCTCGCCGCG GGG (reversed) Intronic