ID: 1132987726

View in Genome Browser
Species Human (GRCh38)
Location 16:2776822-2776844
Sequence GCGCGAGCTGCGCTCGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 133}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132987726_1132987728 -7 Left 1132987726 16:2776822-2776844 CCCGCGGCGAGCGCAGCTCGCGC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1132987728 16:2776838-2776860 CTCGCGCTTCACCCGCACAACGG 0: 1
1: 0
2: 0
3: 1
4: 25
1132987726_1132987737 26 Left 1132987726 16:2776822-2776844 CCCGCGGCGAGCGCAGCTCGCGC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1132987737 16:2776871-2776893 CCCGCGGCTCGGGCGCCCGCAGG 0: 1
1: 0
2: 3
3: 26
4: 238
1132987726_1132987731 10 Left 1132987726 16:2776822-2776844 CCCGCGGCGAGCGCAGCTCGCGC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1132987731 16:2776855-2776877 CAACGGATGTCCCAGTCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 48
1132987726_1132987732 15 Left 1132987726 16:2776822-2776844 CCCGCGGCGAGCGCAGCTCGCGC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1132987732 16:2776860-2776882 GATGTCCCAGTCCCGCGGCTCGG 0: 1
1: 0
2: 0
3: 5
4: 55
1132987726_1132987733 16 Left 1132987726 16:2776822-2776844 CCCGCGGCGAGCGCAGCTCGCGC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1132987733 16:2776861-2776883 ATGTCCCAGTCCCGCGGCTCGGG 0: 1
1: 0
2: 1
3: 5
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132987726 Original CRISPR GCGCGAGCTGCGCTCGCCGC GGG (reversed) Intronic