ID: 1132987729

View in Genome Browser
Species Human (GRCh38)
Location 16:2776849-2776871
Sequence GACTGGGACATCCGTTGTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132987729_1132987739 8 Left 1132987729 16:2776849-2776871 CCCGCACAACGGATGTCCCAGTC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1132987739 16:2776880-2776902 CGGGCGCCCGCAGGCGTCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 178
1132987729_1132987737 -1 Left 1132987729 16:2776849-2776871 CCCGCACAACGGATGTCCCAGTC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1132987737 16:2776871-2776893 CCCGCGGCTCGGGCGCCCGCAGG 0: 1
1: 0
2: 3
3: 26
4: 238
1132987729_1132987743 29 Left 1132987729 16:2776849-2776871 CCCGCACAACGGATGTCCCAGTC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1132987743 16:2776901-2776923 GGCCGCTACTGTTTACATCGCGG 0: 1
1: 0
2: 0
3: 0
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132987729 Original CRISPR GACTGGGACATCCGTTGTGC GGG (reversed) Intronic