ID: 1132987730

View in Genome Browser
Species Human (GRCh38)
Location 16:2776850-2776872
Sequence GGACTGGGACATCCGTTGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132987730_1132987739 7 Left 1132987730 16:2776850-2776872 CCGCACAACGGATGTCCCAGTCC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1132987739 16:2776880-2776902 CGGGCGCCCGCAGGCGTCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 178
1132987730_1132987743 28 Left 1132987730 16:2776850-2776872 CCGCACAACGGATGTCCCAGTCC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1132987743 16:2776901-2776923 GGCCGCTACTGTTTACATCGCGG 0: 1
1: 0
2: 0
3: 0
4: 22
1132987730_1132987737 -2 Left 1132987730 16:2776850-2776872 CCGCACAACGGATGTCCCAGTCC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1132987737 16:2776871-2776893 CCCGCGGCTCGGGCGCCCGCAGG 0: 1
1: 0
2: 3
3: 26
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132987730 Original CRISPR GGACTGGGACATCCGTTGTG CGG (reversed) Intronic