ID: 1132987730 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:2776850-2776872 |
Sequence | GGACTGGGACATCCGTTGTG CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 160 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 7, 4: 152} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1132987730_1132987739 | 7 | Left | 1132987730 | 16:2776850-2776872 | CCGCACAACGGATGTCCCAGTCC | 0: 1 1: 0 2: 0 3: 7 4: 152 |
||
Right | 1132987739 | 16:2776880-2776902 | CGGGCGCCCGCAGGCGTCGCCGG | 0: 1 1: 0 2: 0 3: 12 4: 178 |
||||
1132987730_1132987737 | -2 | Left | 1132987730 | 16:2776850-2776872 | CCGCACAACGGATGTCCCAGTCC | 0: 1 1: 0 2: 0 3: 7 4: 152 |
||
Right | 1132987737 | 16:2776871-2776893 | CCCGCGGCTCGGGCGCCCGCAGG | 0: 1 1: 0 2: 3 3: 26 4: 238 |
||||
1132987730_1132987743 | 28 | Left | 1132987730 | 16:2776850-2776872 | CCGCACAACGGATGTCCCAGTCC | 0: 1 1: 0 2: 0 3: 7 4: 152 |
||
Right | 1132987743 | 16:2776901-2776923 | GGCCGCTACTGTTTACATCGCGG | 0: 1 1: 0 2: 0 3: 0 4: 22 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1132987730 | Original CRISPR | GGACTGGGACATCCGTTGTG CGG (reversed) | Intronic | ||