ID: 1132987731

View in Genome Browser
Species Human (GRCh38)
Location 16:2776855-2776877
Sequence CAACGGATGTCCCAGTCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 48}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132987727_1132987731 9 Left 1132987727 16:2776823-2776845 CCGCGGCGAGCGCAGCTCGCGCT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1132987731 16:2776855-2776877 CAACGGATGTCCCAGTCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 48
1132987726_1132987731 10 Left 1132987726 16:2776822-2776844 CCCGCGGCGAGCGCAGCTCGCGC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1132987731 16:2776855-2776877 CAACGGATGTCCCAGTCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 48
1132987722_1132987731 25 Left 1132987722 16:2776807-2776829 CCCGGACCGGAGATCCCCGCGGC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1132987731 16:2776855-2776877 CAACGGATGTCCCAGTCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 48
1132987723_1132987731 24 Left 1132987723 16:2776808-2776830 CCGGACCGGAGATCCCCGCGGCG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1132987731 16:2776855-2776877 CAACGGATGTCCCAGTCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 48
1132987720_1132987731 26 Left 1132987720 16:2776806-2776828 CCCCGGACCGGAGATCCCCGCGG 0: 1
1: 1
2: 0
3: 2
4: 41
Right 1132987731 16:2776855-2776877 CAACGGATGTCCCAGTCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 48
1132987725_1132987731 11 Left 1132987725 16:2776821-2776843 CCCCGCGGCGAGCGCAGCTCGCG 0: 1
1: 0
2: 1
3: 10
4: 80
Right 1132987731 16:2776855-2776877 CAACGGATGTCCCAGTCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 48
1132987724_1132987731 19 Left 1132987724 16:2776813-2776835 CCGGAGATCCCCGCGGCGAGCGC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1132987731 16:2776855-2776877 CAACGGATGTCCCAGTCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 48
1132987719_1132987731 27 Left 1132987719 16:2776805-2776827 CCCCCGGACCGGAGATCCCCGCG 0: 1
1: 0
2: 1
3: 0
4: 38
Right 1132987731 16:2776855-2776877 CAACGGATGTCCCAGTCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132987731 Original CRISPR CAACGGATGTCCCAGTCCCG CGG Intronic