ID: 1132987733

View in Genome Browser
Species Human (GRCh38)
Location 16:2776861-2776883
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132987726_1132987733 16 Left 1132987726 16:2776822-2776844 CCCGCGGCGAGCGCAGCTCGCGC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1132987733 16:2776861-2776883 ATGTCCCAGTCCCGCGGCTCGGG 0: 1
1: 0
2: 1
3: 5
4: 71
1132987725_1132987733 17 Left 1132987725 16:2776821-2776843 CCCCGCGGCGAGCGCAGCTCGCG 0: 1
1: 0
2: 1
3: 10
4: 80
Right 1132987733 16:2776861-2776883 ATGTCCCAGTCCCGCGGCTCGGG 0: 1
1: 0
2: 1
3: 5
4: 71
1132987723_1132987733 30 Left 1132987723 16:2776808-2776830 CCGGACCGGAGATCCCCGCGGCG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1132987733 16:2776861-2776883 ATGTCCCAGTCCCGCGGCTCGGG 0: 1
1: 0
2: 1
3: 5
4: 71
1132987724_1132987733 25 Left 1132987724 16:2776813-2776835 CCGGAGATCCCCGCGGCGAGCGC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1132987733 16:2776861-2776883 ATGTCCCAGTCCCGCGGCTCGGG 0: 1
1: 0
2: 1
3: 5
4: 71
1132987727_1132987733 15 Left 1132987727 16:2776823-2776845 CCGCGGCGAGCGCAGCTCGCGCT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1132987733 16:2776861-2776883 ATGTCCCAGTCCCGCGGCTCGGG 0: 1
1: 0
2: 1
3: 5
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type