ID: 1132987734

View in Genome Browser
Species Human (GRCh38)
Location 16:2776865-2776887
Sequence GGCGCCCGAGCCGCGGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132987734_1132987745 23 Left 1132987734 16:2776865-2776887 CCCAGTCCCGCGGCTCGGGCGCC 0: 1
1: 0
2: 0
3: 14
4: 108
Right 1132987745 16:2776911-2776933 GTTTACATCGCGGACAGCGTAGG 0: 1
1: 0
2: 0
3: 0
4: 9
1132987734_1132987739 -8 Left 1132987734 16:2776865-2776887 CCCAGTCCCGCGGCTCGGGCGCC 0: 1
1: 0
2: 0
3: 14
4: 108
Right 1132987739 16:2776880-2776902 CGGGCGCCCGCAGGCGTCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 178
1132987734_1132987743 13 Left 1132987734 16:2776865-2776887 CCCAGTCCCGCGGCTCGGGCGCC 0: 1
1: 0
2: 0
3: 14
4: 108
Right 1132987743 16:2776901-2776923 GGCCGCTACTGTTTACATCGCGG 0: 1
1: 0
2: 0
3: 0
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132987734 Original CRISPR GGCGCCCGAGCCGCGGGACT GGG (reversed) Intronic