ID: 1132987737

View in Genome Browser
Species Human (GRCh38)
Location 16:2776871-2776893
Sequence CCCGCGGCTCGGGCGCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 238}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132987729_1132987737 -1 Left 1132987729 16:2776849-2776871 CCCGCACAACGGATGTCCCAGTC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1132987737 16:2776871-2776893 CCCGCGGCTCGGGCGCCCGCAGG 0: 1
1: 0
2: 3
3: 26
4: 238
1132987725_1132987737 27 Left 1132987725 16:2776821-2776843 CCCCGCGGCGAGCGCAGCTCGCG 0: 1
1: 0
2: 1
3: 10
4: 80
Right 1132987737 16:2776871-2776893 CCCGCGGCTCGGGCGCCCGCAGG 0: 1
1: 0
2: 3
3: 26
4: 238
1132987727_1132987737 25 Left 1132987727 16:2776823-2776845 CCGCGGCGAGCGCAGCTCGCGCT 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1132987737 16:2776871-2776893 CCCGCGGCTCGGGCGCCCGCAGG 0: 1
1: 0
2: 3
3: 26
4: 238
1132987730_1132987737 -2 Left 1132987730 16:2776850-2776872 CCGCACAACGGATGTCCCAGTCC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1132987737 16:2776871-2776893 CCCGCGGCTCGGGCGCCCGCAGG 0: 1
1: 0
2: 3
3: 26
4: 238
1132987726_1132987737 26 Left 1132987726 16:2776822-2776844 CCCGCGGCGAGCGCAGCTCGCGC 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1132987737 16:2776871-2776893 CCCGCGGCTCGGGCGCCCGCAGG 0: 1
1: 0
2: 3
3: 26
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132987737 Original CRISPR CCCGCGGCTCGGGCGCCCGC AGG Intronic