ID: 1132987738

View in Genome Browser
Species Human (GRCh38)
Location 16:2776872-2776894
Sequence GCCTGCGGGCGCCCGAGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132987738_1132987743 6 Left 1132987738 16:2776872-2776894 CCGCGGCTCGGGCGCCCGCAGGC 0: 1
1: 0
2: 0
3: 28
4: 183
Right 1132987743 16:2776901-2776923 GGCCGCTACTGTTTACATCGCGG 0: 1
1: 0
2: 0
3: 0
4: 22
1132987738_1132987745 16 Left 1132987738 16:2776872-2776894 CCGCGGCTCGGGCGCCCGCAGGC 0: 1
1: 0
2: 0
3: 28
4: 183
Right 1132987745 16:2776911-2776933 GTTTACATCGCGGACAGCGTAGG 0: 1
1: 0
2: 0
3: 0
4: 9

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132987738 Original CRISPR GCCTGCGGGCGCCCGAGCCG CGG (reversed) Intronic