ID: 1132987739

View in Genome Browser
Species Human (GRCh38)
Location 16:2776880-2776902
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 178}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132987734_1132987739 -8 Left 1132987734 16:2776865-2776887 CCCAGTCCCGCGGCTCGGGCGCC 0: 1
1: 0
2: 0
3: 14
4: 108
Right 1132987739 16:2776880-2776902 CGGGCGCCCGCAGGCGTCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 178
1132987730_1132987739 7 Left 1132987730 16:2776850-2776872 CCGCACAACGGATGTCCCAGTCC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1132987739 16:2776880-2776902 CGGGCGCCCGCAGGCGTCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 178
1132987729_1132987739 8 Left 1132987729 16:2776849-2776871 CCCGCACAACGGATGTCCCAGTC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1132987739 16:2776880-2776902 CGGGCGCCCGCAGGCGTCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 178
1132987735_1132987739 -9 Left 1132987735 16:2776866-2776888 CCAGTCCCGCGGCTCGGGCGCCC 0: 1
1: 0
2: 0
3: 26
4: 182
Right 1132987739 16:2776880-2776902 CGGGCGCCCGCAGGCGTCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type