ID: 1132987740

View in Genome Browser
Species Human (GRCh38)
Location 16:2776886-2776908
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 44}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132987740_1132987743 -8 Left 1132987740 16:2776886-2776908 CCCGCAGGCGTCGCCGGCCGCTA 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1132987743 16:2776901-2776923 GGCCGCTACTGTTTACATCGCGG 0: 1
1: 0
2: 0
3: 0
4: 22
1132987740_1132987747 26 Left 1132987740 16:2776886-2776908 CCCGCAGGCGTCGCCGGCCGCTA 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1132987747 16:2776935-2776957 GTCAGCCCCGTGCCCGGCGCCGG 0: 1
1: 0
2: 0
3: 23
4: 191
1132987740_1132987745 2 Left 1132987740 16:2776886-2776908 CCCGCAGGCGTCGCCGGCCGCTA 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1132987745 16:2776911-2776933 GTTTACATCGCGGACAGCGTAGG 0: 1
1: 0
2: 0
3: 0
4: 9
1132987740_1132987748 27 Left 1132987740 16:2776886-2776908 CCCGCAGGCGTCGCCGGCCGCTA 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1132987748 16:2776936-2776958 TCAGCCCCGTGCCCGGCGCCGGG 0: 1
1: 0
2: 1
3: 21
4: 245
1132987740_1132987746 20 Left 1132987740 16:2776886-2776908 CCCGCAGGCGTCGCCGGCCGCTA 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1132987746 16:2776929-2776951 GTAGGCGTCAGCCCCGTGCCCGG 0: 1
1: 0
2: 1
3: 48
4: 762

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132987740 Original CRISPR TAGCGGCCGGCGACGCCTGC GGG (reversed) Intronic