ID: 1132987743

View in Genome Browser
Species Human (GRCh38)
Location 16:2776901-2776923
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 22}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132987736_1132987743 7 Left 1132987736 16:2776871-2776893 CCCGCGGCTCGGGCGCCCGCAGG 0: 1
1: 0
2: 3
3: 28
4: 185
Right 1132987743 16:2776901-2776923 GGCCGCTACTGTTTACATCGCGG 0: 1
1: 0
2: 0
3: 0
4: 22
1132987738_1132987743 6 Left 1132987738 16:2776872-2776894 CCGCGGCTCGGGCGCCCGCAGGC 0: 1
1: 0
2: 0
3: 28
4: 183
Right 1132987743 16:2776901-2776923 GGCCGCTACTGTTTACATCGCGG 0: 1
1: 0
2: 0
3: 0
4: 22
1132987740_1132987743 -8 Left 1132987740 16:2776886-2776908 CCCGCAGGCGTCGCCGGCCGCTA 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1132987743 16:2776901-2776923 GGCCGCTACTGTTTACATCGCGG 0: 1
1: 0
2: 0
3: 0
4: 22
1132987730_1132987743 28 Left 1132987730 16:2776850-2776872 CCGCACAACGGATGTCCCAGTCC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1132987743 16:2776901-2776923 GGCCGCTACTGTTTACATCGCGG 0: 1
1: 0
2: 0
3: 0
4: 22
1132987735_1132987743 12 Left 1132987735 16:2776866-2776888 CCAGTCCCGCGGCTCGGGCGCCC 0: 1
1: 0
2: 0
3: 26
4: 182
Right 1132987743 16:2776901-2776923 GGCCGCTACTGTTTACATCGCGG 0: 1
1: 0
2: 0
3: 0
4: 22
1132987734_1132987743 13 Left 1132987734 16:2776865-2776887 CCCAGTCCCGCGGCTCGGGCGCC 0: 1
1: 0
2: 0
3: 14
4: 108
Right 1132987743 16:2776901-2776923 GGCCGCTACTGTTTACATCGCGG 0: 1
1: 0
2: 0
3: 0
4: 22
1132987729_1132987743 29 Left 1132987729 16:2776849-2776871 CCCGCACAACGGATGTCCCAGTC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1132987743 16:2776901-2776923 GGCCGCTACTGTTTACATCGCGG 0: 1
1: 0
2: 0
3: 0
4: 22
1132987741_1132987743 -9 Left 1132987741 16:2776887-2776909 CCGCAGGCGTCGCCGGCCGCTAC 0: 1
1: 0
2: 0
3: 5
4: 38
Right 1132987743 16:2776901-2776923 GGCCGCTACTGTTTACATCGCGG 0: 1
1: 0
2: 0
3: 0
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type