ID: 1132989266

View in Genome Browser
Species Human (GRCh38)
Location 16:2784787-2784809
Sequence GTCCCCCAGAATCACCCTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 2, 2: 3, 3: 23, 4: 158}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132989254_1132989266 30 Left 1132989254 16:2784734-2784756 CCAGCTCACCACGCCCACCAGGA 0: 1
1: 1
2: 4
3: 26
4: 306
Right 1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG 0: 1
1: 2
2: 3
3: 23
4: 158
1132989263_1132989266 0 Left 1132989263 16:2784764-2784786 CCCAGACTGCAGGCAGGTCAGAG 0: 1
1: 0
2: 7
3: 38
4: 299
Right 1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG 0: 1
1: 2
2: 3
3: 23
4: 158
1132989256_1132989266 17 Left 1132989256 16:2784747-2784769 CCCACCAGGACCCAGCTCCCAGA 0: 1
1: 0
2: 9
3: 154
4: 2553
Right 1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG 0: 1
1: 2
2: 3
3: 23
4: 158
1132989257_1132989266 16 Left 1132989257 16:2784748-2784770 CCACCAGGACCCAGCTCCCAGAC 0: 1
1: 0
2: 3
3: 134
4: 1798
Right 1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG 0: 1
1: 2
2: 3
3: 23
4: 158
1132989261_1132989266 6 Left 1132989261 16:2784758-2784780 CCAGCTCCCAGACTGCAGGCAGG 0: 1
1: 0
2: 3
3: 50
4: 401
Right 1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG 0: 1
1: 2
2: 3
3: 23
4: 158
1132989258_1132989266 13 Left 1132989258 16:2784751-2784773 CCAGGACCCAGCTCCCAGACTGC 0: 1
1: 0
2: 0
3: 50
4: 544
Right 1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG 0: 1
1: 2
2: 3
3: 23
4: 158
1132989264_1132989266 -1 Left 1132989264 16:2784765-2784787 CCAGACTGCAGGCAGGTCAGAGG 0: 1
1: 0
2: 8
3: 32
4: 270
Right 1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG 0: 1
1: 2
2: 3
3: 23
4: 158
1132989255_1132989266 22 Left 1132989255 16:2784742-2784764 CCACGCCCACCAGGACCCAGCTC 0: 1
1: 0
2: 5
3: 79
4: 486
Right 1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG 0: 1
1: 2
2: 3
3: 23
4: 158
1132989260_1132989266 7 Left 1132989260 16:2784757-2784779 CCCAGCTCCCAGACTGCAGGCAG 0: 1
1: 0
2: 3
3: 41
4: 463
Right 1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG 0: 1
1: 2
2: 3
3: 23
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132989266 Original CRISPR GTCCCCCAGAATCACCCTGC AGG Exonic
900868747 1:5287013-5287035 GTCCCCAAGATTCCCCCTGCTGG - Intergenic
902533387 1:17104919-17104941 CTCGCCCAGCACCACCCTGCGGG - Exonic
902852855 1:19174886-19174908 TTCCACCAGAATCAGCCTACTGG - Intronic
903155427 1:21439574-21439596 GTCTCCCAGTCTCACCCTGTAGG - Intergenic
903291190 1:22315324-22315346 GTTCCCCAGGAGCACCCTTCGGG - Intergenic
904885137 1:33731920-33731942 TTCCCCCACAACCACCCTGCTGG - Intronic
905481512 1:38265138-38265160 CTCCCCCACAATCAAGCTGCAGG - Intergenic
908868258 1:68576596-68576618 GTCCACCAGAAGCACCCTCCTGG - Intergenic
909608913 1:77532793-77532815 TGCCCCCAACATCACCCTGCTGG - Intronic
910216334 1:84848295-84848317 GAACCCCAGAATGCCCCTGCTGG + Intronic
911428993 1:97759101-97759123 GTCCCACAGAAGTACACTGCAGG - Intronic
912586587 1:110772243-110772265 CTCCCCCAGCATTACCCTCCAGG + Intergenic
915074419 1:153296908-153296930 GTCCCCCAAGAGCACCCTGAAGG - Intergenic
916617564 1:166458334-166458356 GTTGCCCAAAATCATCCTGCTGG - Intergenic
917468701 1:175307570-175307592 GTCCCCCAGCCTCACCCCGGCGG - Intergenic
917511781 1:175674809-175674831 GCCCCCCAGCATCAATCTGCTGG + Intronic
920340768 1:205273895-205273917 GGCCACCTGAATCTCCCTGCTGG + Intergenic
921281914 1:213575762-213575784 GTCCCCCAGAAGCATGATGCAGG + Intergenic
924044407 1:240012430-240012452 GTCCCCCAGAGTTAGCATGCTGG - Intergenic
1069956269 10:72053833-72053855 GACCCCCAGGATCACCCTGGAGG - Intergenic
1070388927 10:75951903-75951925 GTCCCCCAGAAAGTCCCTCCAGG - Intronic
1071334155 10:84588011-84588033 TTCTCCCAGCACCACCCTGCAGG - Intergenic
1072720562 10:97778373-97778395 GTCCCCAGGCATCACCCTCCTGG + Intergenic
1075711409 10:124532757-124532779 CTCACCCAGCATCACCCAGCTGG + Intronic
1076091550 10:127690458-127690480 CTCCCCCAAAATCACTTTGCAGG - Intergenic
1076696449 10:132249573-132249595 GTGCCCCTGACTCACCTTGCGGG - Intronic
1076791416 10:132778907-132778929 GTCCCTGAGATGCACCCTGCTGG + Intronic
1077298451 11:1836707-1836729 CTCGGCCAGAATCACCCTCCCGG + Intronic
1077610858 11:3642397-3642419 GTCCCGCAGAAAGACCCCGCAGG - Intergenic
1080339460 11:31243865-31243887 GTATTCCAGAATCTCCCTGCAGG + Intronic
1083140740 11:60719064-60719086 GTGCATCAGAATCACCCAGCAGG - Intergenic
1083142475 11:60733433-60733455 GTGCCCCAGAATCACCCCAGGGG - Intronic
1083550889 11:63589552-63589574 GTCTCCCAGATTCACCCTTAGGG + Intronic
1083746702 11:64741112-64741134 TTCCCCCACCATCACCCAGCAGG + Intronic
1083818338 11:65150741-65150763 GTCAGCCAGAGTCACCCTGCTGG + Intergenic
1084484056 11:69437885-69437907 GCCCCCCAGACCCACCCTGAGGG - Intergenic
1085694358 11:78691261-78691283 GTCCTCCAGGGTCACGCTGCTGG - Intronic
1086858406 11:91895376-91895398 ATCTCCCAGAATCCCCCTTCTGG + Intergenic
1089873449 11:121696851-121696873 GTCACCCAGAATTACACAGCAGG - Intergenic
1093490674 12:19700835-19700857 GTCCCCAAGAAGCACCCCGCTGG - Intronic
1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG + Exonic
1096769944 12:53928650-53928672 CTCCCCCAGAATAAGCCCGCAGG + Intergenic
1097234006 12:57527653-57527675 CTCCCTCAGACTCACCCAGCAGG - Exonic
1103848741 12:123917573-123917595 GTCCCCCACAGTCACGCTGAAGG + Exonic
1103915300 12:124372828-124372850 TTCTCCCAGACTGACCCTGCTGG + Intronic
1104691467 12:130829542-130829564 GTCCCACAGACTCCCCTTGCGGG + Intronic
1104779748 12:131412492-131412514 CTTCTCCAAAATCACCCTGCAGG - Intergenic
1105426003 13:20295700-20295722 GCCCCCCAGGATGTCCCTGCCGG - Intergenic
1108004196 13:45931262-45931284 GTCTCCCAGAACCATCCTCCAGG + Intergenic
1108721141 13:53133932-53133954 TTTGCCCAGAATCACCATGCCGG + Intergenic
1112980649 13:105380720-105380742 GTCCTCCTTTATCACCCTGCTGG - Intergenic
1113795545 13:113055697-113055719 GTCCACCAGGATCACACTCCTGG + Intronic
1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG + Exonic
1121245832 14:92460218-92460240 CTTGCCCAGACTCACCCTGCTGG - Intronic
1121936855 14:98027815-98027837 GACCCTCAGAATCACCCTGATGG - Intergenic
1123891802 15:24788942-24788964 GTCTTGCAGACTCACCCTGCAGG - Intergenic
1125827513 15:42688919-42688941 GGACCTCAGAATCACCTTGCTGG + Exonic
1127670209 15:61187792-61187814 CTTCCCCAGAAGCACCCTGGGGG + Intronic
1130155486 15:81346566-81346588 TTCCTCTAGAATCACCTTGCGGG + Intronic
1131840603 15:96432716-96432738 GTCCCATAGAATCTCCCTGGTGG - Intergenic
1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG + Exonic
1132999009 16:2839916-2839938 GCCCCCCGGAGTCACCCTGGGGG + Intergenic
1136247283 16:28983251-28983273 GGCTCCCAGCATCACCCAGCAGG - Exonic
1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG + Exonic
1139636735 16:68262736-68262758 GTTCCTCAGGACCACCCTGCAGG - Intergenic
1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG + Exonic
1140475858 16:75238954-75238976 ATCCTCCAAAAGCACCCTGCCGG + Intronic
1141927270 16:87177858-87177880 ACCCCCCAGAATCCCCCTCCTGG - Intronic
1142811823 17:2399154-2399176 GCCCCCCAGAATCCCCCGGCAGG - Intronic
1142909256 17:3072978-3073000 GTCCCCCAGAGCCACCATGTGGG + Intergenic
1142925304 17:3231260-3231282 GTCCCCCAGAGCCACCATGTGGG - Intergenic
1143301003 17:5910699-5910721 CTCCTGCAGAATCACCCTCCTGG + Intronic
1143322251 17:6075790-6075812 CTCCCCCTGAAGCACTCTGCAGG + Intronic
1143870450 17:9954334-9954356 GGGCCACAGAAGCACCCTGCAGG + Intronic
1144830502 17:18128424-18128446 CGCCCCCAGGATCACCTTGCTGG - Intronic
1145771529 17:27496655-27496677 ATCCCCCAGGATCCCCTTGCTGG - Intronic
1146654481 17:34626896-34626918 GCCCCCCAGGAGGACCCTGCAGG + Exonic
1148676732 17:49449966-49449988 GTCACCCAGAAACACCCTCACGG - Intronic
1151663977 17:75535052-75535074 GTCTCCCAGAAGCACCAGGCAGG - Intronic
1153975381 18:10264182-10264204 TCCCACCAGAATCAGCCTGCGGG + Intergenic
1157276484 18:46314367-46314389 GTCTCCCAGAGTTCCCCTGCAGG + Intergenic
1160710672 19:549623-549645 GCCCGCCCGAGTCACCCTGCAGG - Exonic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1161101991 19:2425920-2425942 GTCCCCCAGCGTCACCCTGTTGG - Exonic
1163135731 19:15309830-15309852 GTACCCAAGAATCACTGTGCCGG + Intronic
1163288850 19:16365578-16365600 GTCCCCCAGGGTGCCCCTGCCGG - Intronic
1163380966 19:16968316-16968338 GTCCCCCAGGCTCTTCCTGCTGG - Intronic
1165817379 19:38650329-38650351 GTGCCCCAGCCTCACCCTGTAGG - Intronic
1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG + Exonic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
1167675009 19:50878397-50878419 GACCCCCAGAATCACCCTAAGGG - Exonic
1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG + Exonic
1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG + Exonic
1167689695 19:50977676-50977698 GTCCCCCTGAGTCACCCTAGAGG + Exonic
1167705315 19:51078144-51078166 GTCCCCCAGAGTCACCCTGAGGG + Exonic
928296331 2:30087223-30087245 GTCTCCCAGAATCCCCCAGCAGG + Intergenic
929897293 2:45973189-45973211 GTCCCCAAGAACCTCCCTACTGG - Intronic
937242056 2:120468205-120468227 GTCTCCCAGGAGCACCCTGTTGG + Intergenic
939445739 2:142308159-142308181 CTCCCACAGGATCACACTGCTGG - Intergenic
939567690 2:143804004-143804026 GTGCCCCAGCATGACCCGGCTGG + Intergenic
942468595 2:176235135-176235157 TTCCCCCAGAATCCTCCTGCAGG - Intergenic
943957656 2:194213451-194213473 GCACCTCAGAATCAACCTGCTGG - Intergenic
947749035 2:232523409-232523431 GGCCTCCCGAGTCACCCTGCGGG - Exonic
947907242 2:233774314-233774336 GGCTCCCAGAGTCACCCAGCAGG - Intergenic
948107584 2:235427843-235427865 CTCCCTCAGAATCAGCCTCCCGG + Intergenic
1169162976 20:3398126-3398148 GGCCTCCAGGATCACCATGCAGG + Intronic
1171440874 20:25161953-25161975 GTCCCCCAGAGCCATCCTTCAGG + Intergenic
1175317414 20:58058678-58058700 TTCTCCCAGAATCACCATCCTGG - Intergenic
1175909267 20:62396908-62396930 GGCCCCAAGCAACACCCTGCTGG + Intronic
1176050053 20:63114315-63114337 GTCCCCCAGAGACACACTGGAGG + Intergenic
1176107524 20:63396396-63396418 GGCCCACAGCATCAACCTGCTGG - Intergenic
1179567078 21:42255975-42255997 GTCCCCCAGAGTGAACCAGCTGG + Intronic
1179978868 21:44886202-44886224 AGCCCCCAGAAGCACCCGGCCGG + Exonic
1180980358 22:19875471-19875493 GTCCCCCAGGATCGCCCAGGTGG - Intergenic
1181400505 22:22647797-22647819 GTCCCCCAGAGTCCCCTTCCTGG - Intronic
1181648867 22:24247994-24248016 GTCCCCCAGAGTCCCCTTCCTGG + Intergenic
1181702484 22:24628895-24628917 GTCCCCCAGAGTCCCCTTCCTGG - Exonic
1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG + Exonic
950653743 3:14423960-14423982 TCTCCCCAGAATCATCCTGCAGG - Intronic
954642954 3:52113014-52113036 GTGCCTCAGAATCACTCTGAGGG - Intronic
954698751 3:52441033-52441055 GGCCCCCAGCATCATTCTGCAGG + Exonic
955446737 3:59019507-59019529 GTCCCCCTAAATGACCCTGCAGG + Intronic
956332408 3:68126078-68126100 GTCTCCTAGAATCACCTTTCAGG + Intronic
961163508 3:124749071-124749093 CTCCCCAAGTCTCACCCTGCAGG - Intergenic
961654685 3:128434761-128434783 GTTGCCCAGAATCACACAGCTGG - Intergenic
961821086 3:129575998-129576020 GTCCCCCAAAATCCCCTTCCTGG + Intronic
965641594 3:170834618-170834640 GTGCACCAGAATCACCTTGAGGG - Intronic
966729653 3:183140068-183140090 GTCCCCCAAAATCACATTGCTGG + Intronic
968040928 3:195588679-195588701 TTCTCCCAGACTCACCCTCCAGG - Intergenic
968972270 4:3802282-3802304 CTCACCCAGCATCACCCTGCAGG + Intergenic
970625004 4:17867078-17867100 CTCCCCCAGCACCACTCTGCTGG + Intronic
970694405 4:18660052-18660074 GCCCCCAAAAGTCACCCTGCAGG - Intergenic
974831291 4:67192827-67192849 GACCCCAAGAGTCACACTGCCGG + Intergenic
974943459 4:68496636-68496658 GTCCTCCAGAGTCACCCTAAAGG - Exonic
977222229 4:94351739-94351761 GTCGGGCAGAATCACCCTCCGGG + Intergenic
981405611 4:144364298-144364320 CTCCCTCAGAATCAGCTTGCTGG - Intergenic
984825124 4:183917247-183917269 ATCCACCACAATCACCCTGGTGG - Intronic
985937741 5:3109709-3109731 GACCCCCAGATTCACCATGGAGG - Intergenic
989554215 5:42773104-42773126 ATCCTCCAAAATCATCCTGCTGG - Intronic
991290380 5:65028265-65028287 GTGCTTCAGAATCACCCTGCAGG + Intergenic
1000583548 5:163065085-163065107 ATCCTCCAGCATCAGCCTGCAGG - Intergenic
1001717708 5:173830044-173830066 CTCCCTCAGAAGCACCCCGCTGG - Intergenic
1009686489 6:66964278-66964300 GTCACCCAGATTCACCCTTTAGG + Intergenic
1009950624 6:70391658-70391680 GTCCCCCAGAGTTCCCCAGCAGG + Intergenic
1011416718 6:87129605-87129627 GGCCCCCAGAATCCCACTGTAGG + Intergenic
1013339682 6:109201321-109201343 CTCCCACAGAAACACTCTGCTGG - Intergenic
1015915307 6:138210186-138210208 GTCCCCCTAAATTACCCTGATGG + Intronic
1015923333 6:138286974-138286996 GTCCCCCTGCCCCACCCTGCTGG - Intronic
1019148848 6:169991034-169991056 GTCCTCTGCAATCACCCTGCAGG + Intergenic
1019419605 7:944902-944924 GTCACCCAGAGTCACCCCCCCGG - Intronic
1021600090 7:22356567-22356589 GGCCCCCAGATTCAGGCTGCGGG - Intronic
1022192580 7:28031349-28031371 ATCCCCCACCATCACCATGCCGG - Intronic
1022531340 7:31068771-31068793 GTCCCCCAACCTCAGCCTGCAGG - Intronic
1024620835 7:51156431-51156453 TTCCCCAGGAATCACCCAGCAGG + Intronic
1024855644 7:53775540-53775562 TTCCCACAGAATCATCCTGAAGG + Intergenic
1026038243 7:66845168-66845190 GACCCACAGAAACACCGTGCTGG - Intergenic
1029209851 7:98898081-98898103 GAAACCCAGAATCACCCTGCTGG + Intronic
1029260185 7:99296910-99296932 TGCCCTCAGACTCACCCTGCAGG - Intergenic
1029548086 7:101221893-101221915 GTCCCCCAGGATGACCAGGCAGG + Intronic
1029853573 7:103490013-103490035 GTCTTCCTGAAGCACCCTGCTGG + Intronic
1033582915 7:142752861-142752883 GGCCACCAGAATCACCCTGGGGG - Exonic
1033585941 7:142774349-142774371 GGCCACCAGAATCACCCTGGGGG - Intergenic
1035458425 7:159024196-159024218 GTCCTCGAGAATGACCCTGAAGG - Intergenic
1038612657 8:29069988-29070010 GTCCCCCAGAGGCACTTTGCGGG + Exonic
1039837578 8:41269064-41269086 GTCTCCCAGAAGTACCCAGCAGG - Intronic
1040391709 8:46955677-46955699 GCTCCCCAGAATCAGCATGCTGG + Intergenic
1044973862 8:97644649-97644671 GCCCACCAGGATCACCCAGCCGG - Exonic
1048204393 8:132403766-132403788 GGCACCCAGGCTCACCCTGCTGG + Intronic
1051890153 9:21932986-21933008 GTCCCTCAGAATAAACCAGCTGG + Intronic
1053284057 9:36839203-36839225 GTCCCCCAGATCTTCCCTGCTGG + Exonic
1057171639 9:92966524-92966546 GTCCCCCAGCCCCACCCTCCAGG + Intronic
1057492744 9:95534518-95534540 GTTGCCCAGAGTCTCCCTGCAGG + Intergenic
1059281719 9:113139783-113139805 GTCCCACAGAATCCCTGTGCAGG + Intergenic
1060716248 9:125932278-125932300 ATCCACCTTAATCACCCTGCTGG + Intronic
1060890947 9:127187959-127187981 GGCCCACAGAATCAACCTCCAGG + Intronic
1061584717 9:131558307-131558329 GGCCCCCAGATTCCCTCTGCAGG - Intergenic
1061808085 9:133147613-133147635 GTCCCCCAGAGGGACCCTGCCGG + Intronic
1061838187 9:133342754-133342776 GTCCCTCAGCTTCACCCAGCGGG - Intronic
1062386699 9:136314939-136314961 GAGGCCCAGAATGACCCTGCTGG - Intergenic
1186652612 X:11577352-11577374 GTCTCGCAGAGTCTCCCTGCAGG - Intronic
1189430023 X:40938059-40938081 GACCATCAGAATGACCCTGCTGG + Intergenic
1189532621 X:41902020-41902042 GGCCTCCAGACTCACCCTGGCGG - Intronic
1190277124 X:48906023-48906045 GTGCCCCAAAATCACACAGCTGG + Intronic
1190279771 X:48922086-48922108 GGCCCCCAGACAGACCCTGCTGG + Intronic
1192081674 X:68053719-68053741 GGCCCCCAGATCCTCCCTGCCGG - Exonic
1193635388 X:83943894-83943916 CACCCCCAGCATCACTCTGCTGG - Intergenic
1197749448 X:129954616-129954638 GGCGCCCAAAGTCACCCTGCTGG + Intergenic