ID: 1132989663

View in Genome Browser
Species Human (GRCh38)
Location 16:2786276-2786298
Sequence CAGAGCACTGTGAAGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 361}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132989655_1132989663 4 Left 1132989655 16:2786249-2786271 CCGTCTGTTATCTTATTTAACCC 0: 1
1: 0
2: 6
3: 45
4: 404
Right 1132989663 16:2786276-2786298 CAGAGCACTGTGAAGGTGCAGGG 0: 1
1: 0
2: 2
3: 44
4: 361
1132989654_1132989663 17 Left 1132989654 16:2786236-2786258 CCAGGCTTTCGTGCCGTCTGTTA 0: 1
1: 0
2: 0
3: 0
4: 54
Right 1132989663 16:2786276-2786298 CAGAGCACTGTGAAGGTGCAGGG 0: 1
1: 0
2: 2
3: 44
4: 361
1132989653_1132989663 29 Left 1132989653 16:2786224-2786246 CCTGACATTGCGCCAGGCTTTCG 0: 1
1: 0
2: 0
3: 0
4: 65
Right 1132989663 16:2786276-2786298 CAGAGCACTGTGAAGGTGCAGGG 0: 1
1: 0
2: 2
3: 44
4: 361
1132989652_1132989663 30 Left 1132989652 16:2786223-2786245 CCCTGACATTGCGCCAGGCTTTC 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1132989663 16:2786276-2786298 CAGAGCACTGTGAAGGTGCAGGG 0: 1
1: 0
2: 2
3: 44
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132989663 Original CRISPR CAGAGCACTGTGAAGGTGCA GGG Intronic
900707072 1:4087494-4087516 CAGAGCCCTGAGACTGTGCAGGG + Intergenic
902188716 1:14745160-14745182 CAGGGCACTGGGATGGTGCTGGG - Intronic
902521328 1:17018677-17018699 CAGGGGAATGTGAAGGTGCCAGG - Intergenic
902930277 1:19726245-19726267 CAAAGCACTGAGAGGGAGCAGGG + Intronic
903767668 1:25745075-25745097 CAGAAAACTGTGAAGGTGGAGGG - Intronic
903823810 1:26127396-26127418 CAGAGCGCTGTGAAGATAAAAGG + Intergenic
903854846 1:26331047-26331069 CAGACCAGTGAGAAGGGGCAAGG - Intronic
903888828 1:26556567-26556589 CAGAGCCCTGTGAGGCTGCTTGG + Intronic
906528762 1:46511439-46511461 CAGAGCCGTGGGAAGGTCCAGGG + Intronic
907235434 1:53041977-53041999 AAGAGCACTGTTAACGTGCACGG + Intronic
907520575 1:55020846-55020868 CAGAGCACTGTGGAGGGGTCTGG + Intergenic
908783818 1:67715576-67715598 CACAGGACTGAGAAGCTGCATGG + Intronic
910514077 1:88037973-88037995 CAGAGCACTGAGAGGGAGCACGG + Intergenic
915082923 1:153364464-153364486 CAGAGCACTGTGAAGTGTCTGGG - Intergenic
915935270 1:160086966-160086988 CAGAGGACTGTGAAGTGGGAGGG + Intronic
916257494 1:162804599-162804621 CAGAGCAATGGGAAGCTGGAGGG + Intronic
917024214 1:170624583-170624605 CAGACCAGAGTGAATGTGCATGG + Intergenic
917099748 1:171433006-171433028 CTGAGCATTTTGCAGGTGCAAGG + Intergenic
917102260 1:171458536-171458558 CCCAGCACTGTGAAAGTCCAAGG + Intergenic
918006238 1:180544374-180544396 CAGAGCACTGCCAAGGTTCCAGG + Intergenic
918181655 1:182089751-182089773 CAGGGCACTGTGTATGTACAGGG - Intergenic
918448317 1:184635710-184635732 CAGAGCACTCTGGAGGGGCAGGG - Intergenic
919756566 1:201069730-201069752 CAGAGGACCCTGCAGGTGCAGGG - Intronic
919785233 1:201254445-201254467 CAGAGCACTGTGCGGGTTCAAGG + Intergenic
919823907 1:201490338-201490360 CAGACCACTGTGGAGGGGAAGGG + Exonic
919845372 1:201639124-201639146 CAGAGCAAAGCAAAGGTGCAGGG + Intronic
920401509 1:205679519-205679541 CAGAGCTCTGAGAAGCTGCACGG + Intronic
921167505 1:212517443-212517465 CTGGGCACTGTGAGGGTGCTGGG + Intergenic
922464608 1:225838622-225838644 CAGAGCACAGTCAGGGTGGAGGG - Intronic
923046689 1:230361178-230361200 ATGAGCACTGTGGAGGTGGAGGG - Intronic
923802094 1:237220171-237220193 CAGAGGACTCTCAATGTGCATGG + Intronic
924173206 1:241362671-241362693 CAGAGTACAGGGAAGGTACATGG - Intergenic
924835831 1:247646234-247646256 GGGAGCAATGTCAAGGTGCATGG + Intergenic
1063347219 10:5323333-5323355 CAGAGAACTCTGAAGTTGGAAGG + Intergenic
1064428611 10:15252360-15252382 CAGAGTTCAGTGAAGGTGGATGG - Intronic
1064661641 10:17613867-17613889 CAGAGCGCTGTGAAAATACATGG + Intronic
1064701095 10:18023018-18023040 CTTAGCACTGAGAAGGGGCATGG - Intronic
1065116503 10:22488382-22488404 CTGAGCCCTGGGAAGATGCAAGG - Intergenic
1066723943 10:38370285-38370307 CAGAGCAATGGGAAGCTGGAGGG + Intergenic
1067276665 10:44841293-44841315 CAGAGTCCTGAGATGGTGCAGGG - Intergenic
1067300697 10:45006119-45006141 CACAGCACTGTAAGGGTGCCAGG - Intergenic
1067849360 10:49745013-49745035 CAGAGCTCCATGAAGGTGGAAGG + Intronic
1073027375 10:100497873-100497895 TAGAGCACTGAGTAGGGGCAAGG + Intronic
1073550079 10:104391323-104391345 CAGAGCAATGTGACAGAGCATGG - Intronic
1073783854 10:106866610-106866632 CAGAGCACTGAGAGGGAACAAGG + Intronic
1074696908 10:116058082-116058104 CAGCGAACTGAGAAGGTCCAGGG + Intronic
1074899860 10:117806687-117806709 CAGAGCATTGAGAACGTGCAGGG + Intergenic
1075792958 10:125098584-125098606 ATTGGCACTGTGAAGGTGCAGGG - Intronic
1076303490 10:129446560-129446582 CAGACCACTGTGAGGGGGCAGGG - Intergenic
1076704766 10:132295090-132295112 CAGTGCACAGAGCAGGTGCACGG + Intronic
1077167801 11:1151685-1151707 CTGGGCACTGTGGAGATGCATGG + Intergenic
1078100649 11:8328612-8328634 CAAAGCACTGAGAATGTGGATGG - Intergenic
1078238633 11:9509801-9509823 CAGAACACTGTAAGTGTGCATGG + Intronic
1078454896 11:11467357-11467379 AAGGGCTCTGTGAAGGGGCAGGG - Intronic
1079960175 11:26914109-26914131 AAAAGCCATGTGAAGGTGCAGGG + Intergenic
1081693476 11:45094043-45094065 CAGAGCAGTGTGAAGCCACACGG - Intergenic
1082615830 11:55357663-55357685 CAGAGCACTGAGAGGAAGCATGG + Intergenic
1083149806 11:60784728-60784750 CAGAGCTCTGTGGGGCTGCAGGG + Intergenic
1083296807 11:61719396-61719418 AAGAGCACGGTTGAGGTGCAGGG - Intronic
1083470724 11:62881916-62881938 CTGAGCTCTCTGAAGGTGAAGGG + Exonic
1083772113 11:64873628-64873650 CAGAGCACTGTGGAGATGGGAGG + Intronic
1084511392 11:69606593-69606615 CAGAGCACTGTGAACGCAGAAGG + Intergenic
1084732729 11:71083745-71083767 CAGCGTGCTGTGAAGTTGCACGG + Intronic
1084883790 11:72190273-72190295 CTCAGCACTCTGAAGGTGCAGGG + Exonic
1085394663 11:76201221-76201243 CAGAGCAGTGTGAAGGCCCAGGG + Intronic
1086303768 11:85458805-85458827 CAAAGCACTGAGAAGAAGCATGG - Intronic
1091094575 11:132808471-132808493 CAGAGCACTGTGTGGGATCATGG + Intronic
1091178485 11:133582089-133582111 CAGATCACTCTGAAGGAGAAAGG + Intergenic
1091429339 12:419554-419576 AAGAGCACTGTAATGGAGCATGG - Intronic
1091429347 12:419628-419650 AAGAGCACTGTAATGGAGCATGG - Intronic
1091429431 12:420516-420538 AAGAGCACTGTAATGGAGCATGG - Intronic
1091429489 12:421104-421126 AAGAGCACTGTAATGGAGCATGG - Intronic
1091429495 12:421178-421200 AAGAGCACTGTAATGGAGCATGG - Intronic
1091429545 12:421696-421718 AAGAGCACTGTAATGGAGCATGG - Intronic
1091429551 12:421770-421792 AAGAGCACTGTAATGGAGCATGG - Intronic
1091429579 12:422067-422089 AAGAGCACTGTAATGGAGCATGG - Intronic
1091429585 12:422141-422163 AAGAGCACTGTAATGGAGCATGG - Intronic
1091429591 12:422216-422238 AAGAGCACTGTAATGGAGCATGG - Intronic
1092225492 12:6745622-6745644 CAGAGAACCCTGAAGGAGCAAGG + Intergenic
1092572733 12:9742980-9743002 CAGGGCAGTGTGAATGTCCAGGG - Intergenic
1093065680 12:14655803-14655825 CTGAGCACTGTGAAGTAGCAGGG - Intronic
1097193621 12:57232130-57232152 CAGAGAACTGTGGAGTTGAAGGG + Intronic
1098015829 12:66103658-66103680 GAGGGCGCTGTGAAGCTGCATGG - Intergenic
1100607208 12:96161665-96161687 AAGGGCACGGGGAAGGTGCAAGG + Intergenic
1102461242 12:113101030-113101052 TAGAGCACTTTGTAGGTGCCTGG - Intronic
1102633748 12:114304453-114304475 GACACCACTGTGAAGATGCATGG - Intergenic
1103160413 12:118724724-118724746 CAGAGACCTATGAAGGAGCATGG - Intergenic
1107225827 13:38045874-38045896 CAGAGCACTGAGAGGGAGCATGG + Intergenic
1107283389 13:38762111-38762133 CAGAGCACTGTGTGTGTGTATGG + Intronic
1107750351 13:43558465-43558487 CAGAACACTCTGAAGGAGCCAGG + Intronic
1108186377 13:47892385-47892407 CAGAGCGCTGTGGGGGTGCAGGG + Intergenic
1110733101 13:78904175-78904197 CAGAGCAGTGACAAGGTACAAGG - Intergenic
1114497898 14:23146615-23146637 AAGATTACTGTGAAGGTGAAAGG - Intronic
1115739041 14:36368021-36368043 CAGCGCACTTTGGAGGGGCAAGG - Intergenic
1121093375 14:91198727-91198749 CTGAGCACTGAGTAGGTTCAGGG + Intronic
1121450566 14:94004555-94004577 CAGAGGACTGGGAAGGGGCATGG - Intergenic
1121901629 14:97698162-97698184 GAGAGCACTGTGAAGGTGACTGG - Intergenic
1124706667 15:31972249-31972271 GTGAGCACTTTGAAGCTGCACGG - Intergenic
1125802445 15:42462194-42462216 CATAGCACAGTGTAGTTGCATGG + Intronic
1125930799 15:43598739-43598761 CAGAGCTCTGAGCAGGTTCAGGG + Intronic
1125943965 15:43698553-43698575 CAGAGCTCTGAGCAGGTTCAGGG + Intronic
1126744328 15:51810820-51810842 CACAGCACTGTGGGGCTGCAAGG - Exonic
1127370272 15:58332472-58332494 CAGAGCCCTGTGAAGGAGACAGG + Intronic
1127900918 15:63340328-63340350 CAGAGCACAGTGGGGTTGCAAGG + Exonic
1127961180 15:63892035-63892057 CAAATCACAGTGAATGTGCAGGG + Intergenic
1128738575 15:70067649-70067671 CAGAACACAGTGAAGGCCCATGG + Intronic
1128742050 15:70090519-70090541 GTGACCACGGTGAAGGTGCAAGG - Intronic
1128751319 15:70152184-70152206 CAGAGCACTGTGCTGGGGAAAGG - Intergenic
1131797550 15:96034922-96034944 CAGAGCAAAGGGAACGTGCAAGG - Intergenic
1131825042 15:96313905-96313927 CAGTGCACTGTGAGAGGGCATGG - Intergenic
1131865718 15:96707182-96707204 CAGAGCTCTCTGGAGATGCAGGG + Intergenic
1132281207 15:100617476-100617498 CAGAGCAAGGTGATGGGGCAGGG - Intronic
1132989663 16:2786276-2786298 CAGAGCACTGTGAAGGTGCAGGG + Intronic
1133056758 16:3149295-3149317 CAGAGCAGGGTGAACCTGCAGGG + Intronic
1133639374 16:7702014-7702036 CAGTGCACTATGCAGGTACATGG - Intronic
1134411026 16:14003412-14003434 AAGAGCACTGTGAGCGTGCGGGG - Intergenic
1134421083 16:14090557-14090579 CAGAGGACTGTGGTGGTGCCAGG + Intronic
1135673176 16:24392065-24392087 CAGGGCACTCTGAAGGTTCAAGG + Intergenic
1136628925 16:31477898-31477920 CACAGAACAGTGAGGGTGCAGGG - Exonic
1137901695 16:52275722-52275744 CAAAGCAGTGAGAAGGTGCTGGG + Intergenic
1138483010 16:57316642-57316664 CAGGGCACTGTGAATGAGTATGG + Intergenic
1139003524 16:62542779-62542801 CAGAGAAAGGTGAAGGTGAAAGG + Intergenic
1139037957 16:62970504-62970526 CTGAGAAGTTTGAAGGTGCATGG + Intergenic
1140970574 16:80008604-80008626 CAGAGTCCTGAGATGGTGCAGGG - Intergenic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1142471910 17:169429-169451 CACAGCAGTGTGAAGGTAGAAGG + Intronic
1142919207 17:3169803-3169825 CAGGGCACTGGGCAGTTGCAAGG + Intergenic
1143372832 17:6450902-6450924 CAGAGCACTGTGGATGTGCCAGG + Exonic
1144752676 17:17660541-17660563 CAGAGCACAGAGAAATTGCAAGG + Intergenic
1144961769 17:19048370-19048392 CAGAGCCCTGTGGTGTTGCATGG + Intergenic
1144973392 17:19126152-19126174 CAGAGCCCTGTGGTGTTGCATGG - Intergenic
1146142696 17:30381311-30381333 CACAGCATTTTAAAGGTGCAAGG - Intronic
1146953595 17:36923050-36923072 CAGAGCTCTTTGAAGGTGCCTGG + Intergenic
1147583245 17:41638498-41638520 CAGGGCCCTGGGAAGGTGGAGGG - Intergenic
1149433804 17:56616779-56616801 CAAAGCACAGGGAAGGAGCAAGG - Intergenic
1149528625 17:57377537-57377559 CAGGTCACTGAGAAGGTGAAGGG - Intronic
1150465377 17:65388261-65388283 AAGAGCACTGTGAATGTCCCAGG - Intergenic
1150573077 17:66405137-66405159 CAGAGCACAGTGATTGTCCATGG + Intronic
1152440338 17:80304774-80304796 CACAGCAGTGTGAATGTGCTTGG - Intronic
1152686491 17:81696231-81696253 CAGAGGGCTCTGAAGGTGCTGGG - Intronic
1153424439 18:4946287-4946309 CAAAGCACTGAGAAGGAGCATGG + Intergenic
1153586900 18:6631176-6631198 GAGAGGACTGTGATCGTGCATGG + Intergenic
1153636895 18:7120134-7120156 TAGAGCCCTATGAAAGTGCAGGG + Intergenic
1153746251 18:8182874-8182896 TATAGCACTGTGAGTGTGCACGG + Intronic
1153785460 18:8529803-8529825 CAGAGCACTGAGAAGGAACACGG + Intergenic
1154181268 18:12142043-12142065 CAGAGTACTGGGAAGGAACAGGG - Intergenic
1154182636 18:12149541-12149563 CAGAGTACTGGGAAGGAACAGGG + Intergenic
1154969079 18:21389054-21389076 CAGATCACACTGAAGGAGCAGGG + Intronic
1156472271 18:37384661-37384683 CAGAGCAAAGTGAAGGTGGTAGG + Intronic
1157451827 18:47794905-47794927 CAGGGCACTGTGCAGATACAAGG - Intergenic
1157970242 18:52258830-52258852 CAGAGGACTGTGAGGTTCCAAGG + Intergenic
1161196434 19:2989072-2989094 CTGAGGACTTTGAAGATGCATGG + Exonic
1161342931 19:3752754-3752776 CAGGGCCCGGTGCAGGTGCACGG + Intronic
1162104499 19:8362214-8362236 CAGAGCACTGGCAAGGAGAAGGG - Intronic
1162915107 19:13870500-13870522 CATAGCACCAGGAAGGTGCAGGG - Intronic
1164798171 19:31053385-31053407 CAGAGCATTGAGAGGGAGCATGG - Intergenic
1165350321 19:35271713-35271735 CACAGCACTGTGCAAGTGCCAGG + Intronic
1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG + Intergenic
1167771971 19:51526299-51526321 CAGAGCACTAGGAGGGAGCATGG + Intronic
1168459939 19:56546042-56546064 CACAGCACTTAGAACGTGCAAGG - Intronic
925288690 2:2732015-2732037 CACAGCAATGTGAAGGTGACCGG + Intergenic
925288704 2:2732131-2732153 CACAGCAATGTGAAGGTGACCGG + Intergenic
925379678 2:3416564-3416586 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379695 2:3416611-3416633 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379703 2:3416634-3416656 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379712 2:3416658-3416680 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379728 2:3416704-3416726 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379737 2:3416728-3416750 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379755 2:3416774-3416796 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379764 2:3416798-3416820 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379782 2:3416844-3416866 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379791 2:3416868-3416890 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379800 2:3416892-3416914 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379809 2:3416916-3416938 CAGGGCACAGTGAAGGGGCAGGG - Intronic
925614827 2:5735149-5735171 CAGGGCACTGTGAGGGCCCAGGG - Intergenic
925618621 2:5768579-5768601 CCAAGCACTGTGCCGGTGCAAGG + Intergenic
926586201 2:14688313-14688335 CAGAGCACTTTGGAGTTGGAAGG + Intergenic
927459885 2:23289313-23289335 CAAAGTACTGTGGAGGTACAAGG - Intergenic
927761050 2:25754295-25754317 CAGAGAACAGTGAATGTGCTTGG + Intronic
927937422 2:27083564-27083586 CAGACCACTGTGGAGGGCCAGGG + Exonic
928054085 2:28033462-28033484 CAGAGTCCTGAGATGGTGCAAGG + Intronic
928793247 2:34984521-34984543 CTGAGCACAGGGAAGCTGCAGGG - Intergenic
929549112 2:42878223-42878245 CTGAGCCCTGTGAAAGTCCAGGG - Intergenic
931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG + Intergenic
931301046 2:60978511-60978533 GAGAGCACTGGGAAGGTTCTGGG + Intronic
932571835 2:72942345-72942367 GACAGCAGTGTGAGGGTGCAGGG - Exonic
933438322 2:82277344-82277366 CAGAGCATTGAGAGGGAGCACGG - Intergenic
936242658 2:110801222-110801244 GAGAGCACTGGGAAGGAGGAGGG + Intronic
938571709 2:132567501-132567523 CAGAGTGCTGAGGAGGTGCAGGG - Intronic
939472860 2:142646792-142646814 CAAATGATTGTGAAGGTGCAAGG + Intergenic
939995437 2:148915326-148915348 CAGAGCACCTTAATGGTGCAGGG - Intronic
940075514 2:149737267-149737289 CAGATCACTTTGAAGGGGAAAGG + Intergenic
940667991 2:156632437-156632459 TAGAGCACTGTGCAGTTGGATGG - Intergenic
941344231 2:164348098-164348120 CAGAGCACTGAGAAGAAACATGG - Intergenic
941538371 2:166750619-166750641 CACAGCACTTGGAAGGTACATGG + Intergenic
943668139 2:190632199-190632221 CAGAGCCCTGTGAGGCTGCAAGG - Intergenic
946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG + Intronic
948108302 2:235433282-235433304 CAGAGTGCTGTGAAGGTTCTTGG - Intergenic
1168998651 20:2150828-2150850 CAGAGCACTGAGTAGGTGGCTGG - Intronic
1169511406 20:6268131-6268153 CTTAGCACTGTGAAGGCACAGGG + Intergenic
1169649345 20:7849606-7849628 CAGGGCACTATGAAGGGTCATGG - Intergenic
1170107573 20:12767984-12768006 CAGAGGACTCTCAAGTTGCAGGG - Intergenic
1170442057 20:16389220-16389242 CAGGGCCCTGTGCAGCTGCATGG - Intronic
1170467782 20:16638630-16638652 CAGAGCTCAGTGAAGCTGTAGGG + Intergenic
1170790334 20:19503281-19503303 CAGAGCCCTGTGACAGTTCAAGG + Intronic
1171073262 20:22096377-22096399 GAGATCAATGTGAAGCTGCAAGG - Intergenic
1171779046 20:29401774-29401796 CAGACCACGCTGAAGGTTCATGG + Intergenic
1171792403 20:29539207-29539229 CAGAGCACAGAGAATGTTCACGG - Intergenic
1172222928 20:33286083-33286105 CAGAGAAGGGTGAAGGTCCACGG - Exonic
1172854678 20:37992851-37992873 CACAGAACTGTGAAGGCCCAGGG + Intronic
1173468042 20:43299978-43300000 CAGAGCCATGTGAAAGTGGAAGG + Intergenic
1174289755 20:49499651-49499673 CAGGCCACTGTGAAGCTCCACGG + Intergenic
1175056173 20:56200563-56200585 AAGAGCACTTTGATGATGCAGGG + Intergenic
1176242340 20:64080880-64080902 CAGAGTTCTGTGAAGGTGTAAGG - Intronic
1176447324 21:6831434-6831456 CTGAGCACAGTGCAGGTGCTGGG + Intergenic
1176825492 21:13696460-13696482 CTGAGCACAGTGCAGGTGCTGGG + Intergenic
1179090483 21:38260858-38260880 CAGAGCAGTCTTAATGTGCAGGG + Intronic
1179218984 21:39389811-39389833 CAGAGCAAGGTGCAGGTGCAGGG - Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1181521094 22:23449208-23449230 CAGAGCACATTGAAGGTTAAGGG - Intergenic
1183515635 22:38264280-38264302 CAGAGCCCTGAGAAGGGTCAAGG - Intronic
1184356089 22:43980466-43980488 CAGAGCACGGTGAGGGAGCAAGG + Intronic
1184769814 22:46590389-46590411 CAGAGAGCTGAGAAGGTGCCGGG + Intronic
1185292411 22:50033701-50033723 CAGAGATCAGTGAAGGGGCAGGG + Intronic
950600916 3:14035054-14035076 CAGAGCATTGAGAGGGAGCATGG - Intronic
950718910 3:14868544-14868566 CATAGCACAGAGAAAGTGCATGG - Intronic
951197132 3:19836642-19836664 CAGAGCACTGAGAAGGAACATGG + Intergenic
951268826 3:20601651-20601673 CAGAGCACTGAAAGGGAGCATGG - Intergenic
951519749 3:23600247-23600269 CAGAGTAATGGGAAGGTGTAAGG - Intergenic
951948758 3:28174040-28174062 CAGAACACTGAGAAGTTGAATGG - Intergenic
952017826 3:28979659-28979681 CAGACCACTGTGAACTTTCATGG - Intergenic
952891932 3:38048876-38048898 CACAGCACAGTGTAGCTGCAAGG + Intronic
953335667 3:42091881-42091903 CAGAGAACTGTGAAGGGAAAGGG - Intronic
955021497 3:55126119-55126141 CTGAGCACTGGGAATGTGCCTGG - Intergenic
956642854 3:71431016-71431038 CAAAGCATTTAGAAGGTGCATGG + Intronic
957238988 3:77633858-77633880 CAGAGCAGTGAGAACGTGCAAGG + Intronic
957894908 3:86409766-86409788 TAGAGGTCTGTGAAGGTGGAAGG - Intergenic
958931659 3:100214114-100214136 CAGAGCACTAGGAAGGGACAAGG + Intergenic
959206074 3:103308707-103308729 CAAAGCACTTTGAAGATGAAAGG + Intergenic
959351837 3:105275013-105275035 CAGTGCTTTGTGAAGCTGCAGGG + Intergenic
959520112 3:107316146-107316168 CAGAGCATTGAGAGGGAGCATGG - Intergenic
960519483 3:118638581-118638603 CAGAGCCCTGTGGAGCTGGAAGG + Intergenic
961096069 3:124157963-124157985 CAGAGCACTGTTAAGGAGAAAGG + Intronic
961511854 3:127408304-127408326 CACAGCACTGTTCAGATGCAGGG + Intergenic
961546179 3:127635162-127635184 CAGTACACTGTGAAGGAGAAAGG - Intronic
961558478 3:127712693-127712715 TTGAGCACTGTGCAGGGGCATGG + Intronic
962921853 3:139957535-139957557 ATGAGCTATGTGAAGGTGCAGGG + Intronic
968419708 4:473738-473760 CACAGCCCGGGGAAGGTGCAGGG + Intronic
970131469 4:12876204-12876226 AAGAGCACTGTGAGGCTTCAGGG - Intergenic
972642576 4:40939040-40939062 CAGAGCCCTGAGTGGGTGCAGGG - Intronic
973047350 4:45551502-45551524 GACAGCACTGGGAAGGTGCTTGG - Intergenic
974158538 4:58105907-58105929 CAGTGCACTGTGTAAGTGTAAGG + Intergenic
975404192 4:73969803-73969825 CAGAGTGCTGAGAAGGAGCATGG + Intergenic
977005868 4:91569233-91569255 CAGAGCAATGAGAAGGAACATGG - Intronic
978208320 4:106105510-106105532 CAGAGCACTGAGAGGGAACATGG + Intronic
978443924 4:108762911-108762933 CAGGGCGCTGCGAAGGTGCAAGG + Exonic
980334331 4:131450796-131450818 CAGAGCACTGGGAAGCTGTAGGG - Intergenic
981717760 4:147768472-147768494 GAGACCACTGTGATGGGGCAAGG - Intronic
982321859 4:154085175-154085197 CAGAGCACTGAGAGTGTGCTTGG + Intergenic
982767947 4:159369273-159369295 GAGAGATCTGTGAAGGAGCAGGG + Intergenic
984000939 4:174243743-174243765 CTGAGCAGTGTGTATGTGCATGG + Intronic
985588819 5:754500-754522 CTGAGCACGGTGGAGATGCAAGG - Intronic
985603432 5:846628-846650 CTGAGCACGGTGGAGGCGCAAGG - Intronic
985603482 5:846901-846923 CTGAGCACGGTGGAGGCGCAAGG - Intronic
985603501 5:847017-847039 CTGAGCACGGTGGAGATGCAAGG - Intronic
987730682 5:21768287-21768309 CAAAGCATTGTGAAGGTATAAGG - Intronic
987732354 5:21791160-21791182 CAGAGCACTGGGAAGATGCCAGG - Intronic
988731574 5:33977762-33977784 CAGAGCACAGAGAATGTGGAAGG + Intronic
989410566 5:41115510-41115532 CAGAGCAGTGTGCAGCTCCATGG + Intergenic
990246384 5:53867410-53867432 CAGAGCAGTGGGAAAGAGCACGG - Intergenic
990504917 5:56434487-56434509 CAGAGCATTGTAGAGGTGGAAGG - Intergenic
991229275 5:64312008-64312030 CAGAGCCATTTGAGGGTGCAAGG + Intronic
992245909 5:74822221-74822243 CAGAGGACTTTGAAGATGTAAGG - Intronic
992549288 5:77845957-77845979 AAGAGCAAGGTGGAGGTGCAGGG + Intronic
992646052 5:78812200-78812222 CAGAGCAGTGGGCAGGTGCTCGG + Intronic
992845545 5:80743326-80743348 GAGAGCACAGAGAAGGTACAAGG - Intronic
993138802 5:84003457-84003479 CAGAGCACTGAGAGAGTGCATGG + Intronic
993280797 5:85921709-85921731 CAGAGCACTGAGAAAGAGCAAGG + Intergenic
993339668 5:86707918-86707940 TGGAGTACTGTGAATGTGCATGG + Intergenic
993413570 5:87600354-87600376 CAGAGCATTGAGAAGGAGCATGG - Intergenic
995253549 5:110019885-110019907 CAGAGCACTGAGAAGGAGTATGG + Intergenic
995385562 5:111585085-111585107 CATAGCACTGTGAGAATGCAGGG + Intergenic
995675153 5:114654877-114654899 CAGGGCACTGTGAAATTGGAGGG - Intergenic
996750051 5:126879229-126879251 CAGAAAAGGGTGAAGGTGCATGG - Intronic
997065837 5:130557249-130557271 CAGAGCACTGAGAGGGATCATGG + Intergenic
997410063 5:133684264-133684286 CAGAGGAAGGTGAGGGTGCAGGG - Intergenic
997698724 5:135881338-135881360 CAGAGCCCTGCCAGGGTGCACGG + Intronic
998135195 5:139670855-139670877 CAGTGGACTGTGAATGTGCCCGG - Intronic
998201504 5:140127246-140127268 CAGAGCACTGTGTGGTTGGAGGG + Exonic
998948856 5:147371252-147371274 CAGACCACTGTGGGGCTGCATGG - Intronic
999166068 5:149550758-149550780 CCGAGCACTTTGGGGGTGCACGG + Intronic
1000153475 5:158527174-158527196 CAGAGCTCTGAGGTGGTGCAGGG - Intergenic
1000268750 5:159662910-159662932 CAGAGTTCTGAGATGGTGCAGGG + Intergenic
1000698713 5:164421776-164421798 CAGAGCACTGAGAGGGAACATGG - Intergenic
1001171752 5:169425824-169425846 TAGAGCACTGGCAAGGTGCCAGG + Intergenic
1001685540 5:173592285-173592307 CAAAGCAGTGTGAATGTCCATGG - Intergenic
1001788234 5:174432187-174432209 CAGAGCACTGTGTGGATTCAGGG + Intergenic
1002964450 6:1949202-1949224 CAGCTCACTGTGAAGGTGATGGG - Intronic
1003232713 6:4269202-4269224 CAGAGCCCTGAGGTGGTGCAGGG - Intergenic
1003261561 6:4521290-4521312 CAGGGCAGTATGAAGATGCAGGG - Intergenic
1004290437 6:14362214-14362236 CAGAGCACTGTGAAAGTAATGGG + Intergenic
1005128344 6:22474011-22474033 CTGAGCACTGTGATGGTTAATGG - Intergenic
1005440110 6:25858222-25858244 CAGAGAAATGTCAAAGTGCATGG - Intronic
1005835059 6:29702597-29702619 CAGAGCCCTGTCCAGGTGCTGGG + Intergenic
1005886470 6:30101416-30101438 CAAAGCCCTGTGCAGGTCCACGG + Intergenic
1005920526 6:30397142-30397164 CAGAGCCCTGTCCAGGTGCTGGG - Intergenic
1008127562 6:47685992-47686014 CAGAGGCCTGTTGAGGTGCATGG - Intronic
1011684870 6:89815947-89815969 CAGAGCACTGTGGGTGTGCCAGG + Intronic
1012572341 6:100744267-100744289 TAGAGCACTGGGAAGGAGAATGG + Intronic
1013596140 6:111662794-111662816 CAGGGCACTGTGGGGTTGCAGGG - Intronic
1013745569 6:113341907-113341929 AAGAACACAGTGAAGATGCATGG - Intergenic
1013942529 6:115681829-115681851 CACAGCACAGTGAGTGTGCAGGG - Intergenic
1014506320 6:122263146-122263168 CAGACCAATGTGATGGAGCATGG - Intergenic
1015197355 6:130537755-130537777 CAGAGAACTGAGAAGGAACATGG + Intergenic
1017564250 6:155667175-155667197 CCCAGCGCTGTGAAGGTGAAAGG - Intergenic
1018584833 6:165346197-165346219 CATAGACCTGTGAAGGGGCAAGG + Intronic
1018598344 6:165508933-165508955 CTGAGCTCTCTGTAGGTGCAGGG - Intronic
1018720230 6:166566529-166566551 CAGAGCTCTGCACAGGTGCAGGG + Intronic
1018763733 6:166912869-166912891 CAAAGCACCCTGAATGTGCAAGG - Intronic
1019137781 6:169922114-169922136 GAGAGCCCTGTGAAGGAGGAAGG + Intergenic
1020513856 7:9091393-9091415 CAGAGCACTGTGACGGAGCATGG + Intergenic
1022189738 7:28005781-28005803 CAGATAACTGAGAAGGTCCAGGG - Intronic
1022648274 7:32251637-32251659 CCAGGCACTGTGCAGGTGCAGGG - Intronic
1022671885 7:32463372-32463394 TTGACCACTGTGAAGGTGCCTGG + Intergenic
1023165107 7:37335943-37335965 CAGGGCACTGTGGTGGTTCATGG + Intronic
1023230868 7:38027591-38027613 GAGAGCACTGTGGAGCTGCAGGG + Intergenic
1023838067 7:44079978-44080000 CAGGTCACTGTGAGGCTGCAGGG + Intronic
1024178472 7:46864085-46864107 CAGGGCACAGTGAAGGTGGAGGG - Intergenic
1024561135 7:50646326-50646348 CACAACACTATGAAGCTGCAGGG + Intronic
1024964836 7:55015159-55015181 CAGAGCCCAGTCATGGTGCAGGG - Intergenic
1026105535 7:67417917-67417939 CAGAGCAGGGTGGAGCTGCATGG - Intergenic
1028053925 7:86220391-86220413 CAGAGCACTGAGAGGGAGCATGG + Intergenic
1028077311 7:86532996-86533018 CAGAGCACTGAGAGGGGGCATGG - Intergenic
1028293395 7:89096241-89096263 CTGAACACTGTGATGATGCATGG + Intronic
1028399675 7:90411259-90411281 CAGAGCATGATGAAGGGGCAAGG - Intronic
1029216972 7:98957554-98957576 CTGAGCACTGAGACGGTGCTGGG - Intronic
1029957897 7:104659061-104659083 CACAGAACTGTGTAAGTGCATGG - Intronic
1030083791 7:105800033-105800055 AAGACCACTTTGAAGGTGCTGGG + Intronic
1030379430 7:108795388-108795410 CTGAACACTGTGGAGGTGCATGG + Intergenic
1032010850 7:128346854-128346876 AAGAGCACTGTGATGGAGAAGGG + Intergenic
1034753522 7:153592745-153592767 CAGAGAAGTGTGAAGGTGCTGGG + Intergenic
1034971652 7:155423319-155423341 CAGAGCCCTGTGGAGATGAATGG + Intergenic
1036168463 8:6459831-6459853 CTGAGTAATGTGAAGGTGCCAGG + Intronic
1036715911 8:11123860-11123882 GAGAGCACAGTGCAGGTGCCAGG - Intronic
1037408757 8:18571487-18571509 CAGAGAGCTGTGGAGGTTCAAGG - Intronic
1037682213 8:21106859-21106881 CAGAGGGCTGAGAAGGAGCAGGG + Intergenic
1038233490 8:25728662-25728684 CAGAGCACTGAGAGGGAACATGG - Intergenic
1038323602 8:26552633-26552655 CAGAGTTCTGAGGAGGTGCAGGG + Intronic
1041012865 8:53560572-53560594 CAGAGCATTGAGAGGGGGCATGG + Intergenic
1042805247 8:72764176-72764198 CAGAGCACAGTGACGGAGAAAGG + Intronic
1043280992 8:78465966-78465988 CAGAGCACTGAGAGGGAACATGG + Intergenic
1043943855 8:86228101-86228123 AAGAGCACAGTAAAAGTGCAAGG + Intronic
1045640172 8:104241074-104241096 CAGAGCACAGTGAAGGAGTCAGG - Intronic
1046042155 8:108918848-108918870 CATAGAACTGTGAAGTTGGAAGG + Intergenic
1046255618 8:111693622-111693644 CAGAGCACTGAGAGGAAGCATGG - Intergenic
1048016095 8:130499035-130499057 CACAGCCCTGAGCAGGTGCATGG - Intergenic
1048089024 8:131218611-131218633 CAGAGTACTGTGAGGGTGACAGG + Intergenic
1048424194 8:134307479-134307501 CAGAGGACTGGTAAGGTTCAAGG + Intergenic
1048873840 8:138821229-138821251 CAGCGCACAGTCAATGTGCAGGG + Exonic
1049174462 8:141183030-141183052 CAGGGCAGTGTGAAGGGGCGAGG - Intronic
1049463431 8:142740370-142740392 CAGAGCACTGTGACTGTGATGGG + Intergenic
1050412588 9:5382307-5382329 CAGGGCATTATGAAAGTGCATGG + Intronic
1051823562 9:21194090-21194112 CATAGCATTGAGAAGGAGCACGG + Intergenic
1051973406 9:22919213-22919235 CAGAGCACTGGAAGGGTGAAGGG + Intergenic
1052034889 9:23669382-23669404 CTGAACACTGTGTAGGTGCAGGG + Intergenic
1052094540 9:24368934-24368956 CAGAGCACTGAGAGGGAACATGG - Intergenic
1055373261 9:75623716-75623738 CAGAGCATTGAGAGGGAGCATGG - Intergenic
1057226407 9:93295645-93295667 CAGAGCACTGTGATGCAACAGGG + Intronic
1058135379 9:101301913-101301935 CACAGCACTGAGAAGAGGCAAGG - Intronic
1059165704 9:112074494-112074516 CAGAGGACAGTGAAGGTTCTAGG - Intronic
1059934632 9:119297348-119297370 CAGGGCGCTGAGAAGGTGAAGGG - Intronic
1060140860 9:121208852-121208874 TAGAGCACCTTGAAGGTCCAGGG + Intronic
1060531976 9:124353048-124353070 CAGAGCTGTGTGAAGGTGGGTGG - Exonic
1060726077 9:126006765-126006787 CAGAGCACTGTGGCAGTGCTTGG - Intergenic
1061342291 9:129992147-129992169 CACAGCAATGTGAAGAGGCAGGG + Intronic
1061385454 9:130286866-130286888 CAGAGCCCTGTCCAGGAGCAAGG - Intronic
1061735671 9:132655729-132655751 TTGAGCACTTTGAATGTGCAAGG - Intronic
1062081553 9:134626692-134626714 CACATCACTGGGAGGGTGCAGGG + Intergenic
1062672939 9:137722604-137722626 CAGAGCACACCGCAGGTGCAGGG - Intronic
1203521866 Un_GL000213v1:53097-53119 CTGAGCACAGTGCAGGTGCTGGG - Intergenic
1185758889 X:2674084-2674106 CAGAGCCCTGAGAAGGAGAAGGG - Intergenic
1186124627 X:6400104-6400126 GAGAGCACTTTGAAGCTGAAAGG - Intergenic
1186338427 X:8617427-8617449 CAGAGCCACGTGAAGGGGCAAGG + Intronic
1187345163 X:18457315-18457337 CTAAGCACTGTGTAGGTGCTAGG + Intronic
1187671934 X:21676102-21676124 GAGAGCCCTGTGAAGCTCCAAGG - Intergenic
1188555533 X:31408213-31408235 CAGAGCACAGCAAAGCTGCATGG + Intronic
1188717454 X:33477221-33477243 CAGAGCACTAAGAGGGAGCATGG + Intergenic
1188791839 X:34414625-34414647 CAGAGCATTGAGAGGGAGCAAGG + Intergenic
1188895001 X:35656597-35656619 CAGAGCAATCTGAAGATTCAAGG - Intergenic
1190094562 X:47468304-47468326 CAGAGCACTTTGAAGGTAGCAGG - Intronic
1192084719 X:68084823-68084845 CAGAGCTCAGAGAAGGTGCTTGG + Intronic
1192289108 X:69772938-69772960 CAGAGCACTGTGAATATACTAGG - Intronic
1192756392 X:74050278-74050300 CAGAGCACTTAGAAGAAGCATGG + Intergenic
1192866010 X:75132602-75132624 CAAAGCACTGAGAGGGAGCATGG + Intronic
1193440455 X:81534812-81534834 CAGAGCACTGAGAGGGTGCAGGG - Intergenic
1194040624 X:88938137-88938159 CAGAGCACTGAGAGGGAGCATGG - Intergenic
1196496509 X:116329774-116329796 CACAGCAATGAGAAGGAGCATGG + Intergenic
1196715983 X:118811511-118811533 CAGGGCACTGTCAAGGGACAGGG + Intergenic
1197588115 X:128374459-128374481 CAGAGCTCTGTGAACTTCCAGGG - Intergenic
1199182348 X:144873251-144873273 CAGAGCACTGAGAGGAAGCATGG - Intergenic
1199559781 X:149150657-149150679 CAGAGCACTGAGAGGGAGCATGG - Intergenic
1199778161 X:151033845-151033867 CAGAGAACTCTGAGGGTGAATGG + Intergenic
1199848753 X:151710413-151710435 CACAGCCCTGAGAAGCTGCATGG - Intergenic
1199980834 X:152919605-152919627 CAGAGGACTGAGGAGGGGCAAGG - Intronic
1200162351 X:154016051-154016073 CAGAGGGCTGTGAAGACGCACGG - Exonic
1201605935 Y:15785175-15785197 GAGAGCACTTTGAAGCTGAAAGG - Intergenic