ID: 1132994915

View in Genome Browser
Species Human (GRCh38)
Location 16:2817796-2817818
Sequence CCCGTCGGCCGCATGGTCCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 44}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132994915_1132994924 21 Left 1132994915 16:2817796-2817818 CCGAGGACCATGCGGCCGACGGG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1132994924 16:2817840-2817862 GTGGAGAGGACGCCGAACTCGGG 0: 1
1: 1
2: 0
3: 4
4: 55
1132994915_1132994922 7 Left 1132994915 16:2817796-2817818 CCGAGGACCATGCGGCCGACGGG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1132994922 16:2817826-2817848 GTCGCGCATCGTGGGTGGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 50
1132994915_1132994923 20 Left 1132994915 16:2817796-2817818 CCGAGGACCATGCGGCCGACGGG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1132994923 16:2817839-2817861 GGTGGAGAGGACGCCGAACTCGG 0: 1
1: 0
2: 1
3: 5
4: 89
1132994915_1132994925 27 Left 1132994915 16:2817796-2817818 CCGAGGACCATGCGGCCGACGGG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1132994925 16:2817846-2817868 AGGACGCCGAACTCGGGCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 15
1132994915_1132994919 -2 Left 1132994915 16:2817796-2817818 CCGAGGACCATGCGGCCGACGGG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1132994919 16:2817817-2817839 GGTCATCACGTCGCGCATCGTGG 0: 1
1: 0
2: 0
3: 0
4: 9
1132994915_1132994921 2 Left 1132994915 16:2817796-2817818 CCGAGGACCATGCGGCCGACGGG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1132994921 16:2817821-2817843 ATCACGTCGCGCATCGTGGGTGG 0: 1
1: 0
2: 0
3: 0
4: 11
1132994915_1132994920 -1 Left 1132994915 16:2817796-2817818 CCGAGGACCATGCGGCCGACGGG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1132994920 16:2817818-2817840 GTCATCACGTCGCGCATCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 7

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132994915 Original CRISPR CCCGTCGGCCGCATGGTCCT CGG (reversed) Exonic