ID: 1132995057

View in Genome Browser
Species Human (GRCh38)
Location 16:2818421-2818443
Sequence CATTGAGCCAAGGCCTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132995057_1132995065 2 Left 1132995057 16:2818421-2818443 CCCCTGGAGGCCTTGGCTCAATG 0: 1
1: 0
2: 2
3: 13
4: 156
Right 1132995065 16:2818446-2818468 AGGCTCCTTGGGACAGCTCTGGG 0: 1
1: 0
2: 2
3: 28
4: 210
1132995057_1132995066 5 Left 1132995057 16:2818421-2818443 CCCCTGGAGGCCTTGGCTCAATG 0: 1
1: 0
2: 2
3: 13
4: 156
Right 1132995066 16:2818449-2818471 CTCCTTGGGACAGCTCTGGGAGG 0: 1
1: 0
2: 1
3: 35
4: 245
1132995057_1132995064 1 Left 1132995057 16:2818421-2818443 CCCCTGGAGGCCTTGGCTCAATG 0: 1
1: 0
2: 2
3: 13
4: 156
Right 1132995064 16:2818445-2818467 AAGGCTCCTTGGGACAGCTCTGG 0: 1
1: 0
2: 0
3: 36
4: 229
1132995057_1132995062 -10 Left 1132995057 16:2818421-2818443 CCCCTGGAGGCCTTGGCTCAATG 0: 1
1: 0
2: 2
3: 13
4: 156
Right 1132995062 16:2818434-2818456 TGGCTCAATGCAAGGCTCCTTGG 0: 1
1: 0
2: 6
3: 18
4: 174
1132995057_1132995063 -9 Left 1132995057 16:2818421-2818443 CCCCTGGAGGCCTTGGCTCAATG 0: 1
1: 0
2: 2
3: 13
4: 156
Right 1132995063 16:2818435-2818457 GGCTCAATGCAAGGCTCCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132995057 Original CRISPR CATTGAGCCAAGGCCTCCAG GGG (reversed) Intronic
900626123 1:3609469-3609491 CTGTGAGCAGAGGCCTCCAGTGG + Intronic
900923292 1:5687457-5687479 AATGGAGCCAAGGGCTGCAGAGG + Intergenic
901068701 1:6506731-6506753 CACTGAGCCGAGGCCCCCAGAGG + Intronic
904862617 1:33550141-33550163 CATTGAGGAAAGAGCTCCAGTGG - Intronic
905794456 1:40807761-40807783 CATTCAGCCAAGGTCCCTAGAGG - Intronic
909513562 1:76482513-76482535 CACTGGGCCAAGTCCTCCACAGG + Intronic
913511774 1:119568908-119568930 CATTGAGCAACCGACTCCAGGGG - Intergenic
916600599 1:166289785-166289807 CATTTTGCCATGGCCTCCAGAGG + Intergenic
916952473 1:169794904-169794926 CAGTGAGTCGAGTCCTCCAGGGG + Exonic
920978441 1:210808457-210808479 AATTGAGCAAGGGCCTCCTGAGG - Intronic
922255304 1:223888483-223888505 GGTTGAGCCAAGCCCTTCAGAGG + Intergenic
1064431141 10:15270665-15270687 CTTTGAGACAAAGCTTCCAGAGG + Intronic
1066051721 10:31642849-31642871 CCATCAACCAAGGCCTCCAGAGG + Intergenic
1066157939 10:32697958-32697980 CTTTGAGACAAAGCTTCCAGAGG + Intronic
1068477900 10:57551635-57551657 CACTGAGACAAAGCTTCCAGAGG - Intergenic
1070600928 10:77865781-77865803 CTTTGTGCCAAGGCCTCCTCGGG - Intronic
1072373776 10:94793712-94793734 CTTTGAGACAAAGCTTCCAGAGG - Intronic
1073790954 10:106939905-106939927 CTTTGAGCAAAGGCCACCAGAGG - Intronic
1076550330 10:131273712-131273734 CACTGGCCCAAGGTCTCCAGAGG + Intronic
1076704402 10:132293442-132293464 CAGTGAGCCAAGCCCTCCCTTGG + Intronic
1077454967 11:2672969-2672991 CCTTTAGGCAAGGCCTGCAGGGG - Intronic
1079231104 11:18649505-18649527 CAGTGAGCCAAGGCCACCACTGG + Intergenic
1079295095 11:19225962-19225984 CATTGGACCAAAGCCTCCAGCGG + Intronic
1079799710 11:24853983-24854005 CTCTGAGACAAAGCCTCCAGAGG - Intronic
1083606443 11:63981701-63981723 CCATGAGCCAAGGACTGCAGGGG + Intronic
1084045286 11:66564591-66564613 CAATGAGCCAAGGGCTGCAGAGG + Exonic
1084958365 11:72703354-72703376 CAGTCAGCCAGAGCCTCCAGAGG + Intronic
1085397140 11:76212229-76212251 CAGAGAGCAAAGGCCTCCGGGGG + Intergenic
1090491186 11:127162332-127162354 CATTGAGCTAAGAACCCCAGGGG + Intergenic
1091457534 12:618876-618898 TTTAGAGCCAAGGCCTCCAATGG + Intronic
1091891322 12:4056928-4056950 TACAGAGCCAAGGCCTGCAGAGG + Intergenic
1096044831 12:48553559-48553581 CTCTGAGACAAGGCTTCCAGAGG - Intergenic
1096385859 12:51195014-51195036 CATTCCAGCAAGGCCTCCAGGGG + Intronic
1097214654 12:57401282-57401304 CACCGAGCCCAGGCCTCAAGAGG + Intronic
1100649117 12:96565643-96565665 CACAGAGCCAAGGCCTATAGAGG + Intronic
1101707362 12:107232977-107232999 CAGTGAGCAAAACCCTCCAGTGG + Intergenic
1102503839 12:113371612-113371634 CACTGAGGCAAGGCCACAAGTGG + Intronic
1104178091 12:126351978-126352000 CATTGGGCCAGGTCCACCAGAGG - Intergenic
1105661035 13:22495655-22495677 CATTGAACCCAGGGCTCCAAAGG + Intergenic
1119099613 14:71867854-71867876 CAAGGAGCCAAGGCCTCCCAGGG + Intergenic
1119569286 14:75655809-75655831 CATTGAGCTAAGGCATCCAGTGG + Intronic
1122662308 14:103305257-103305279 CATTGAGCCAAGACCCCCACCGG - Intergenic
1123008719 14:105336899-105336921 CACTGACGCAGGGCCTCCAGGGG + Intronic
1127737113 15:61852102-61852124 CATTGAGCCCATGCCTTCCGTGG - Intergenic
1128114815 15:65098575-65098597 ATTTCAGCCAAGGCCTCAAGAGG + Intronic
1129563298 15:76593599-76593621 CTCTGAGACAAAGCCTCCAGAGG + Intronic
1131297933 15:91168473-91168495 CCTTGAGACAAGGCCAGCAGAGG + Intronic
1132652781 16:1029071-1029093 AAGGGGGCCAAGGCCTCCAGAGG - Intergenic
1132995057 16:2818421-2818443 CATTGAGCCAAGGCCTCCAGGGG - Intronic
1139819901 16:69713082-69713104 CATGGAGCCACTGCCACCAGTGG + Exonic
1140448856 16:75053888-75053910 CAATGAGCCAAAGCCAGCAGAGG - Intronic
1141965407 16:87438871-87438893 CATGGAGCCTATGGCTCCAGAGG + Intronic
1142150751 16:88511568-88511590 CCTTGAGCCAAGTCCTCAGGAGG + Intronic
1142892960 17:2957164-2957186 CATTGAACCGAGGCCTCCAGGGG - Intronic
1143780249 17:9225505-9225527 GGCTGAGGCAAGGCCTCCAGTGG + Intronic
1143862184 17:9898996-9899018 CTTGGAGCCAAGGCCACCACAGG + Intronic
1144621055 17:16818765-16818787 CCTGGAGCCCAGGCCTGCAGAGG + Intergenic
1145867802 17:28251815-28251837 TTTTGAGCTAATGCCTCCAGGGG - Intergenic
1145944316 17:28761499-28761521 CTTTGGGCCAAGGCCACCTGAGG - Intronic
1147190102 17:38733475-38733497 CCTGGAGCCAAGGCCACCTGTGG - Exonic
1147437619 17:40427208-40427230 CATTCACAGAAGGCCTCCAGTGG - Intergenic
1147573031 17:41583058-41583080 CCTGGAGCCCAGGCCTGCAGAGG + Intronic
1147675452 17:42202256-42202278 CTTTGACCCCAGCCCTCCAGGGG + Intronic
1148822268 17:50366516-50366538 CATGGAGCCAACATCTCCAGCGG + Intergenic
1151844603 17:76643588-76643610 ACCTGAGCCAAGGCGTCCAGTGG - Exonic
1151887146 17:76929800-76929822 CATTAAGCCAAGAGCTCCTGGGG - Intronic
1152664012 17:81556912-81556934 CATTGACCCCAGCCCTGCAGTGG - Exonic
1154401509 18:14042940-14042962 CTCTGAGACAAGGCTTCCAGAGG - Intergenic
1156456024 18:37294756-37294778 AATTGAGCCATGGCCTCAGGTGG - Intronic
1157288773 18:46395231-46395253 CCTTGAGCCCACGTCTCCAGGGG + Intronic
1158031071 18:52965834-52965856 CATTGAGCTAATGGATCCAGTGG - Intronic
1158197997 18:54909969-54909991 CTTTTAGCCCAGGCATCCAGTGG + Intronic
1158541928 18:58365047-58365069 AATGGAGCCCAGGCCACCAGAGG - Intronic
1160498012 18:79386504-79386526 CATGGAGACAGGGACTCCAGAGG - Intergenic
1160844543 19:1160585-1160607 CAGTGAGCCGAGACCCCCAGTGG - Intronic
1161687683 19:5711469-5711491 CCCTGTGCCAAAGCCTCCAGCGG - Intronic
1161776861 19:6268150-6268172 GATTGAGCCCAGGCAGCCAGAGG + Intronic
1162549525 19:11350892-11350914 CCCTGACCCAAGGCCTTCAGGGG + Exonic
1165752771 19:38270907-38270929 CGGTGGGCCAAGGCCTCCTGGGG - Intronic
1166544971 19:43628696-43628718 TATTGAGCCTAGGCCTGAAGAGG + Intronic
1167125379 19:47545284-47545306 CATCGAGCCACAGCTTCCAGTGG - Exonic
1167161800 19:47772718-47772740 CATGGAGCCAGGGACTCCTGGGG + Intergenic
925565535 2:5250076-5250098 CATTCAGTCAAGGCCTGCTGTGG - Intergenic
928239555 2:29574686-29574708 CTTTGAGGCAGGGCCTCCTGCGG + Intronic
937251281 2:120525395-120525417 CATCCAGCCAAGGCTGCCAGAGG + Intergenic
940066057 2:149631252-149631274 CAATGAGCCCAGGCCTACACAGG + Intergenic
941755802 2:169184451-169184473 CAGTCAGCCCAGACCTCCAGAGG - Intronic
943761547 2:191614924-191614946 CATTGAGCCAAGCCCTGATGAGG - Intergenic
943987317 2:194639531-194639553 CTGTGAGACAAAGCCTCCAGAGG + Intergenic
944619935 2:201504087-201504109 TATTCAGCCAAAGACTCCAGAGG + Intronic
948612562 2:239179163-239179185 CATGGAGCACAGGCATCCAGTGG - Intronic
949020599 2:241739085-241739107 CATGGGGGCAAGGCCGCCAGAGG - Intronic
1169051155 20:2578977-2578999 CCTTGAGCCCAGGCTGCCAGAGG - Intronic
1169276520 20:4236827-4236849 CCATGAGCCAAGACATCCAGTGG + Intronic
1169448660 20:5692879-5692901 CATGGAGACAAGGGGTCCAGTGG + Intergenic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1171163411 20:22949503-22949525 CTTGGAGCCAAGGCCACCAATGG + Intergenic
1171399669 20:24864740-24864762 CATTGGGCCATGGCTTCCAAGGG + Intergenic
1175870645 20:62208041-62208063 CTTTCTGCCATGGCCTCCAGGGG + Intergenic
1180033520 21:45229066-45229088 CAAGCAGCCAATGCCTCCAGGGG + Intergenic
1180830394 22:18902913-18902935 CACAGAGCAAAGGCCTTCAGTGG + Intergenic
1181306476 22:21920016-21920038 CTCTGAGCCCAGGCCTGCAGGGG - Exonic
1182878823 22:33715592-33715614 CATTTAACCCAGCCCTCCAGAGG - Intronic
1203280483 22_KI270734v1_random:128184-128206 CACAGAGCAAAGGCCTTCAGTGG + Intergenic
949834134 3:8249703-8249725 AAAAGAGCCAAGACCTCCAGTGG + Intergenic
950632351 3:14290934-14290956 CAAGGAGCCACTGCCTCCAGAGG + Intergenic
953774303 3:45802400-45802422 CATTGGACCAAGACCCCCAGGGG - Intergenic
953926464 3:46985171-46985193 CCTTGGGCCCAGGCATCCAGCGG + Intronic
954689690 3:52388994-52389016 CATGGAGGCGAGGCCTCAAGGGG - Intronic
956588668 3:70890106-70890128 AATGGAGCTAAGGCCTCCACTGG - Intergenic
958045390 3:88278494-88278516 CCTTGAGCCAAGGCCCACAGTGG - Intergenic
959505443 3:107151820-107151842 GAGTGAGCCAAGGCCCCAAGAGG - Intergenic
960710863 3:120526702-120526724 AATGGAGGCAAGGCCTCTAGAGG - Intergenic
961076210 3:123985031-123985053 CATTCTGCCATGGCCTCTAGTGG - Intronic
963055305 3:141181785-141181807 CTTCGTGTCAAGGCCTCCAGGGG - Intergenic
964605177 3:158553204-158553226 CACTGAAACATGGCCTCCAGGGG - Intergenic
966806235 3:183809985-183810007 AAGTGAGCCAGGGCCTCCTGTGG + Intronic
968727884 4:2256681-2256703 CATTTAGCCAGGGCCTCATGGGG - Intronic
968964750 4:3764222-3764244 AATAGAGACAAGGGCTCCAGCGG + Intergenic
969591784 4:8126334-8126356 CACAGTGCCAGGGCCTCCAGCGG - Intronic
972045798 4:34663686-34663708 CATAGAGCCAGGGGCCCCAGGGG + Intergenic
974052483 4:56953828-56953850 CTTTGAGCTTCGGCCTCCAGAGG + Intergenic
974470273 4:62310033-62310055 CTTTGAGACAAAGCTTCCAGAGG + Intergenic
975227599 4:71892175-71892197 CACTGGGACAAGGCTTCCAGGGG + Intergenic
976487965 4:85630595-85630617 CATGGAGCCTAGGTCTGCAGAGG + Intronic
982812752 4:159846807-159846829 CATTCAACCAAGGCCTCAAGAGG - Intergenic
985546135 5:510076-510098 CAATGCCCCCAGGCCTCCAGCGG - Intronic
989302261 5:39908069-39908091 CTTTGAGACAAAACCTCCAGAGG + Intergenic
995270669 5:110216861-110216883 CTTTGAGACAAAGCTTCCAGGGG - Intergenic
996514961 5:124359018-124359040 CTCTGAGACAAAGCCTCCAGAGG + Intergenic
997057979 5:130467455-130467477 CATGGAGCCAAGATCTGCAGGGG - Intergenic
998767277 5:145501850-145501872 CACTGAGTCATGGCCTTCAGAGG - Intronic
1001430911 5:171661317-171661339 CACTGAGCCAAGCACTCCACAGG + Intergenic
1002916082 6:1528947-1528969 CCATGGGCCAAAGCCTCCAGGGG + Intergenic
1003177662 6:3764815-3764837 CATTGGGCCAGGCCCTCCAAGGG - Intergenic
1007109361 6:39304144-39304166 CATTGTCCCCAGGCCTCCTGAGG + Intronic
1007198353 6:40083214-40083236 CATTATGCTAAGGCATCCAGTGG + Intergenic
1007712835 6:43835638-43835660 CATTGAGACAACCCTTCCAGAGG + Intergenic
1007887115 6:45242390-45242412 TATTTAGCCAAAGCCTCAAGGGG - Intronic
1013124443 6:107169830-107169852 CTCTGAGACAAGGCTTCCAGAGG - Intronic
1015937482 6:138417737-138417759 CACTCAACCAAGGACTCCAGGGG - Exonic
1016779389 6:147941381-147941403 CATACAGCCAAGCCCTCCAGAGG - Intergenic
1018670056 6:166169720-166169742 CTTTGGCCCAAGGCCTCCCGAGG + Intergenic
1019392176 7:794768-794790 CATCACGCAAAGGCCTCCAGAGG + Intergenic
1020561665 7:9735827-9735849 GTTTGAGGTAAGGCCTCCAGTGG + Intergenic
1026362966 7:69619641-69619663 CATGGAGCCAAGGCCCACAGAGG - Intronic
1026891582 7:73985756-73985778 CCTTGGGCCAAGGACCCCAGAGG - Intergenic
1028737690 7:94236019-94236041 CATTGAATCAAGGGCTACAGTGG - Intergenic
1028801318 7:94969509-94969531 CACTGAGACAAAGCTTCCAGAGG - Intronic
1029304896 7:99611856-99611878 CAGTGATCCAAGCCCTCCACTGG + Intergenic
1029788862 7:102821305-102821327 CACTGGGCCCAGGCCTGCAGGGG - Intronic
1030771030 7:113475288-113475310 CATTGGGACAAAGCTTCCAGAGG - Intergenic
1036516183 8:9446660-9446682 CACTGAGACAAAGCTTCCAGAGG - Intergenic
1041665853 8:60444339-60444361 CTTTGAGACAAAGCGTCCAGAGG - Intergenic
1044275743 8:90297611-90297633 CATTGTGCCACTGCCTGCAGTGG - Intergenic
1044896796 8:96901095-96901117 CAGTGAGACAATGCCTGCAGGGG - Intronic
1045928303 8:107596643-107596665 CACTGAGACAAAGCATCCAGAGG - Intergenic
1052408063 9:28087706-28087728 CTTTGAGCCAAGTACACCAGTGG + Intronic
1053123558 9:35562588-35562610 CACTGAGCCAAGGCATCCTGGGG + Intronic
1054455756 9:65429572-65429594 CATTCAGGCAGGGTCTCCAGAGG + Intergenic
1055048344 9:71954145-71954167 AGTTGAGTCAAGGGCTCCAGTGG + Intronic
1058044976 9:100348668-100348690 CCTCCAGCCAAGGCCTCCTGAGG - Intronic
1059308525 9:113373139-113373161 CACTGACCCCAGGCTTCCAGAGG + Intergenic
1185782265 X:2859726-2859748 CATTGGGACAAGTCCTTCAGAGG + Intronic
1186336131 X:8590589-8590611 CATTAAGCCACAGCCCCCAGAGG + Intronic
1189273062 X:39765288-39765310 CTTTTAACCAAGCCCTCCAGGGG - Intergenic
1191895186 X:65985191-65985213 AATTGGGCCAAGGATTCCAGAGG - Intergenic
1193086094 X:77448584-77448606 CACTGAGGCAAGGAGTCCAGAGG - Intronic
1194196059 X:90894066-90894088 CATTGAGCCCCAGCCTGCAGAGG - Intergenic
1199549311 X:149041085-149041107 CATTAAGACAAGGCTTTCAGTGG - Intergenic
1200049477 X:153421263-153421285 CAGTGCGCCAAGGCCTTCAAGGG + Exonic
1200541903 Y:4468247-4468269 CATTGAGCCCCAGCCTGCAGAGG - Intergenic