ID: 1132997268

View in Genome Browser
Species Human (GRCh38)
Location 16:2829836-2829858
Sequence GACCCAGGCCGAGCTCGACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132997268_1132997272 -6 Left 1132997268 16:2829836-2829858 CCGCGTCGAGCTCGGCCTGGGTC No data
Right 1132997272 16:2829853-2829875 TGGGTCCCAGGAAGGCTGCCAGG No data
1132997268_1132997279 23 Left 1132997268 16:2829836-2829858 CCGCGTCGAGCTCGGCCTGGGTC No data
Right 1132997279 16:2829882-2829904 GTGCTGCCTGAGTCCGAAGGAGG No data
1132997268_1132997278 20 Left 1132997268 16:2829836-2829858 CCGCGTCGAGCTCGGCCTGGGTC No data
Right 1132997278 16:2829879-2829901 CAGGTGCTGCCTGAGTCCGAAGG No data
1132997268_1132997275 1 Left 1132997268 16:2829836-2829858 CCGCGTCGAGCTCGGCCTGGGTC No data
Right 1132997275 16:2829860-2829882 CAGGAAGGCTGCCAGGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132997268 Original CRISPR GACCCAGGCCGAGCTCGACG CGG (reversed) Intergenic
No off target data available for this crispr