ID: 1132999009

View in Genome Browser
Species Human (GRCh38)
Location 16:2839916-2839938
Sequence GCCCCCCGGAGTCACCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132998998_1132999009 13 Left 1132998998 16:2839880-2839902 CCTGGATCCACGTATCATTGATG 0: 1
1: 0
2: 0
3: 10
4: 36
Right 1132999009 16:2839916-2839938 GCCCCCCGGAGTCACCCTGGGGG 0: 1
1: 0
2: 2
3: 14
4: 129
1132998996_1132999009 30 Left 1132998996 16:2839863-2839885 CCAGCTCACAATGCCGGCCTGGA 0: 1
1: 0
2: 0
3: 14
4: 82
Right 1132999009 16:2839916-2839938 GCCCCCCGGAGTCACCCTGGGGG 0: 1
1: 0
2: 2
3: 14
4: 129
1132998997_1132999009 17 Left 1132998997 16:2839876-2839898 CCGGCCTGGATCCACGTATCATT 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1132999009 16:2839916-2839938 GCCCCCCGGAGTCACCCTGGGGG 0: 1
1: 0
2: 2
3: 14
4: 129
1132999002_1132999009 6 Left 1132999002 16:2839887-2839909 CCACGTATCATTGATGGGGCAGA 0: 1
1: 0
2: 0
3: 4
4: 35
Right 1132999009 16:2839916-2839938 GCCCCCCGGAGTCACCCTGGGGG 0: 1
1: 0
2: 2
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132999009 Original CRISPR GCCCCCCGGAGTCACCCTGG GGG Intergenic
904079609 1:27863701-27863723 GGCCCCCATGGTCACCCTGGTGG + Intergenic
908356617 1:63329463-63329485 GGCCTCCGGGGTCACCCTGGAGG + Intergenic
912626494 1:111209052-111209074 GCCACCATGAGTCAACCTGGGGG - Intronic
916747775 1:167697666-167697688 ACCCCCCACAGTCCCCCTGGAGG + Exonic
917974943 1:180232530-180232552 GCCTCCCTGGGCCACCCTGGGGG - Intronic
918218676 1:182415793-182415815 TCCCCCAGAAGACACCCTGGAGG + Intergenic
920831590 1:209470408-209470430 GCCCCCTGGAGCCACACTTGGGG + Intergenic
920933871 1:210412931-210412953 GCCCACAGGAGCCACCCTTGGGG + Intronic
1063150883 10:3335280-3335302 CGACCCCGGAGTCACACTGGAGG - Intergenic
1066455691 10:35569483-35569505 GCCCTCTGGAGTCCCCATGGGGG + Exonic
1069956269 10:72053833-72053855 GACCCCCAGGATCACCCTGGAGG - Intergenic
1070388956 10:75952056-75952078 GAGCCCAGGAGTCACCCCGGGGG + Intronic
1070809834 10:79292147-79292169 TCCCCCTGCAGTTACCCTGGGGG + Exonic
1073042250 10:100615622-100615644 GCCCCGCTGGGGCACCCTGGGGG + Intergenic
1075632911 10:124011884-124011906 GCCCCCCGGTGACATCCTGTTGG + Intronic
1076716197 10:132365220-132365242 GCCCCCCGGCGTGAGTCTGGAGG + Intronic
1080606495 11:33869172-33869194 AGCCCCCGGAATCACCCGGGAGG + Intronic
1084484056 11:69437885-69437907 GCCCCCCAGACCCACCCTGAGGG - Intergenic
1089363045 11:117903792-117903814 GCCCCCCGCTGTCTCCCTGCAGG + Exonic
1091838863 12:3604999-3605021 GCACCCAGCATTCACCCTGGGGG + Intergenic
1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG + Exonic
1101940084 12:109093432-109093454 GAATCCCGCAGTCACCCTGGTGG + Exonic
1104482716 12:129122100-129122122 GCCACATGGAGTCACACTGGCGG - Intronic
1106590250 13:31092431-31092453 GCCCACCGGAGTCACACAGCAGG + Intergenic
1107727951 13:43318950-43318972 GCCCCACAGAGTCAACCTGGAGG + Intronic
1112216436 13:97434816-97434838 GCACCCCGGAGTCACCGTCCCGG + Intronic
1113877474 13:113603313-113603335 GCCCCCTGGACACACCCTGGCGG + Intronic
1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG + Exonic
1124434725 15:29637684-29637706 GCCCACCTGAGGAACCCTGGAGG - Intergenic
1129150270 15:73684169-73684191 GCCCCCAGGCCTGACCCTGGCGG - Intronic
1130985179 15:88840145-88840167 GCCAGCCGGCGTCACACTGGTGG - Exonic
1132370569 15:101295082-101295104 CGCCCCCGGACTCACCCCGGAGG + Exonic
1132496062 16:264061-264083 GCCCTCCCGAGCCTCCCTGGGGG + Exonic
1132574213 16:657227-657249 GCCCCCTGCAGCCACTCTGGGGG + Intronic
1132704564 16:1237513-1237535 GCCCTCCCGAGTCACCCTGAGGG + Intergenic
1132706949 16:1248912-1248934 GCCCTCCCGAGTCACCCTGAGGG - Intergenic
1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG + Exonic
1132999009 16:2839916-2839938 GCCCCCCGGAGTCACCCTGGGGG + Intergenic
1136180448 16:28548323-28548345 GCCCCACGGGGTCAACATGGAGG + Intergenic
1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG + Exonic
1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG + Exonic
1142413075 16:89926026-89926048 GCCGCCTGCAGTCACCCCGGGGG + Intronic
1143548512 17:7614600-7614622 GGCCCCCGGCGTCTCCCCGGAGG + Exonic
1151320394 17:73349160-73349182 GGGCCCCGGAGCCAGCCTGGCGG + Intronic
1151605196 17:75131328-75131350 GCCCCCAGGAGCCTCCCTGCGGG - Intronic
1157483844 18:48073392-48073414 CCCAGCCTGAGTCACCCTGGCGG + Intronic
1160550995 18:79693845-79693867 GCCCCTCCGAGTCTCCCTGAAGG + Intronic
1160710672 19:549623-549645 GCCCGCCCGAGTCACCCTGCAGG - Exonic
1160774214 19:847743-847765 GGCCACCTGAGTCTCCCTGGAGG - Intronic
1160774229 19:847792-847814 GGCCACCTGAGTCTCCCTGGAGG - Exonic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1161101991 19:2425920-2425942 GTCCCCCAGCGTCACCCTGTTGG - Exonic
1161155793 19:2731471-2731493 GCCCCCCCCAGTCAGCCTTGTGG + Intronic
1161223863 19:3133269-3133291 GCCCCCTGGGCTCACCCTGTGGG + Intergenic
1162201400 19:9023270-9023292 GACACCTGCAGTCACCCTGGGGG + Intergenic
1162417186 19:10544910-10544932 GCCCGCCGGAGTGTCCCTGGTGG + Intronic
1162490565 19:10988918-10988940 ACCCCTCGGAGTGACCCTAGAGG - Intronic
1164898316 19:31896786-31896808 CCTCCCCCGAGTCACCCTCGCGG + Intergenic
1165421400 19:35723797-35723819 GCCCCCCGGCGTGGGCCTGGAGG - Exonic
1166741783 19:45118805-45118827 GCCCCAGGGAGCCACCCAGGTGG + Intronic
1167264085 19:48474772-48474794 CCCACCCTGAGTAACCCTGGGGG + Intronic
1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG + Exonic
1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG + Exonic
1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG + Exonic
1167689695 19:50977676-50977698 GTCCCCCTGAGTCACCCTAGAGG + Exonic
1167695751 19:51014937-51014959 GGCCTCCAGAGTCACTCTGGGGG + Exonic
1167705315 19:51078144-51078166 GTCCCCCAGAGTCACCCTGAGGG + Exonic
1168301445 19:55407395-55407417 GCGGCCCGCAGTCTCCCTGGCGG - Intronic
934687760 2:96334101-96334123 GCACCCAGGAGTCATCCTGGGGG - Intergenic
934853132 2:97713712-97713734 GCCCCCTGGGGTGGCCCTGGTGG - Intronic
937972860 2:127564146-127564168 GCCACACGTGGTCACCCTGGAGG - Exonic
940035709 2:149310445-149310467 GCCTCCGGGAGTCCCCCTGTTGG - Intergenic
941951486 2:171160821-171160843 GGCCCCCGGCGTCGCCCGGGAGG + Exonic
947749035 2:232523409-232523431 GGCCTCCCGAGTCACCCTGCGGG - Exonic
948993134 2:241564656-241564678 GCCTGCCTGGGTCACCCTGGCGG - Intronic
949035609 2:241814574-241814596 GCCCCCCGGGCCCACCCTGCTGG + Exonic
1168772098 20:421879-421901 GGCTCCTGGAGTCACCCAGGTGG + Intronic
1169143938 20:3240434-3240456 GCCTCCTGGAGTCGCGCTGGGGG - Intergenic
1171483349 20:25469375-25469397 GCCCCCCTGACTCTCACTGGTGG + Intronic
1171988134 20:31675149-31675171 GCCCTCCAGAGTCACCCAAGAGG - Intronic
1172080370 20:32335954-32335976 GCCTGCTGGAGTGACCCTGGGGG + Intergenic
1173525808 20:43731737-43731759 GCCCCCCAGAGCATCCCTGGAGG + Intergenic
1173897185 20:46560009-46560031 GACCCTCTGAGTCCCCCTGGAGG - Exonic
1175129132 20:56775997-56776019 GCTGCCCTGTGTCACCCTGGGGG - Intergenic
1175844126 20:62049709-62049731 TCCCTCTGGAGTGACCCTGGTGG - Intronic
1176050053 20:63114315-63114337 GTCCCCCAGAGACACACTGGAGG + Intergenic
1180041447 21:45282313-45282335 GCCCCCCGGGAGCAGCCTGGAGG - Intronic
1180181979 21:46122101-46122123 GCCTGCCGGGGTCTCCCTGGAGG - Exonic
1180878186 22:19185087-19185109 GCCTCCTGGAGTCTTCCTGGAGG - Intronic
1181452603 22:23033957-23033979 GCCCACCGGAGTCACCTGGCAGG - Intergenic
1181542874 22:23583330-23583352 GCCCCCGGGTGTGTCCCTGGGGG + Intergenic
1182214828 22:28707134-28707156 GCCCCAGGCAGTGACCCTGGAGG - Intronic
1184563738 22:45278663-45278685 GCCCCTTGGAGTCACCAAGGAGG + Intergenic
953664425 3:44915847-44915869 GCCCCCTGGAGTCTCCTAGGGGG - Intronic
953848786 3:46449550-46449572 GGCCCCCGGATTCATCCAGGAGG + Intronic
954797309 3:53168172-53168194 GACCCCTGGAGTCAGCCTGTGGG + Intronic
959546141 3:107598967-107598989 GCCCCAGGCAGTGACCCTGGGGG + Intronic
965071736 3:163923824-163923846 GCCCCCCCTATTCATCCTGGGGG + Intergenic
966901809 3:184492187-184492209 GCGCCCCGGACTGAACCTGGGGG - Intronic
967272803 3:187744719-187744741 GCCTCCCGGAGTTACCCAGAAGG + Intronic
968830638 4:2931577-2931599 GCCCGGCGGATCCACCCTGGCGG - Exonic
969238917 4:5887314-5887336 AACCTCTGGAGTCACCCTGGAGG + Intronic
970694405 4:18660052-18660074 GCCCCCAAAAGTCACCCTGCAGG - Intergenic
973820497 4:54658207-54658229 GCCACCTGGAGTCTCCCCGGAGG - Intronic
976220510 4:82753448-82753470 GCGCCCCAGAGTCACGCGGGTGG + Intronic
985679034 5:1246428-1246450 GGCCCCCTGAGCCACCCGGGCGG - Intergenic
985680714 5:1254244-1254266 GCCCCCGGGCCTGACCCTGGGGG - Intronic
985777990 5:1855224-1855246 ACCCCCAGTAGTGACCCTGGGGG + Intergenic
985937741 5:3109709-3109731 GACCCCCAGATTCACCATGGAGG - Intergenic
987127850 5:14831516-14831538 GCCCCCCGTCGTCCCCCAGGGGG - Intronic
990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG + Intronic
998132776 5:139659666-139659688 GCCCCCCGGAACCTCCCAGGAGG - Intronic
1001304852 5:170564485-170564507 GCCCCCGCAATTCACCCTGGAGG - Intronic
1002175310 5:177398196-177398218 GCCCCCCAGGGTCTTCCTGGAGG + Exonic
1002771105 6:291897-291919 GGCCCCCGGAGTCGCCCCAGGGG + Intronic
1006361655 6:33590366-33590388 GCCCCCCTGAGTCAGCCAGGAGG + Intergenic
1007590321 6:43017031-43017053 GCCTCCAAGTGTCACCCTGGGGG - Intronic
1015785770 6:136921276-136921298 GCCACGCGGAGTCTCCCTGCAGG + Intergenic
1016927021 6:149361146-149361168 GCCCCACAGAGTCTCCATGGGGG - Intronic
1018355497 6:163010884-163010906 GCCCCACTGAGTAACTCTGGAGG - Intronic
1019165390 6:170094855-170094877 GCAGTCAGGAGTCACCCTGGTGG + Intergenic
1019183989 6:170210150-170210172 GCCCCCGGGATTCCCCGTGGTGG + Intergenic
1019556840 7:1636117-1636139 GGCCCAGGAAGTCACCCTGGAGG + Intergenic
1019929608 7:4214980-4215002 GCCCCCCAGTGCCACCCAGGTGG + Intronic
1026840581 7:73668229-73668251 GCCCCGCGGAGCCACCCCCGGGG + Intronic
1026895256 7:74006675-74006697 GCACCCTGGAATGACCCTGGGGG - Intergenic
1032538490 7:132684316-132684338 GGCCCCCTCAGACACCCTGGAGG - Intronic
1033582915 7:142752861-142752883 GGCCACCAGAATCACCCTGGGGG - Exonic
1033585941 7:142774349-142774371 GGCCACCAGAATCACCCTGGGGG - Intergenic
1033605862 7:142928243-142928265 GGCCCCCTGACTCATCCTGGTGG - Intronic
1036634310 8:10538469-10538491 GCCCCCCACTGTCACCCTGTGGG - Exonic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1037827562 8:22168387-22168409 CCCCCCCGGAGAGACCTTGGAGG + Intronic
1040308960 8:46226829-46226851 GCCCCCAGGACTGTCCCTGGTGG + Intergenic
1045227074 8:100259130-100259152 GCCACCCGAAGTCATGCTGGCGG - Exonic
1047510697 8:125513190-125513212 TCCCCTCTGAGTCACCCTGTGGG - Intergenic
1047764116 8:127976518-127976540 GCCCCCAGAAGTCACTCAGGAGG + Intergenic
1051655691 9:19379828-19379850 GCCCCGCGGAATGACTCTGGGGG + Intronic
1059375337 9:113876440-113876462 GCCCCCCGGGGTCCCCCGCGCGG - Intronic
1059718886 9:116939438-116939460 CCCTCCAAGAGTCACCCTGGAGG + Intronic
1060553253 9:124495576-124495598 GCCCACCGTAGACACCCAGGTGG + Intronic
1060794184 9:126503557-126503579 TCACCACGGAGTCACCCTGAGGG + Exonic
1189532621 X:41902020-41902042 GGCCTCCAGACTCACCCTGGCGG - Intronic
1195884410 X:109624627-109624649 GCCCCTCGGAGGCAAGCTGGCGG + Exonic
1199991624 X:152990547-152990569 GCCCCCCGGCCTCTCCCTGATGG + Exonic
1200787532 Y:7273708-7273730 TCTCCCCGGAGTCGCACTGGCGG - Intergenic