ID: 1132999272

View in Genome Browser
Species Human (GRCh38)
Location 16:2840986-2841008
Sequence GAGCCTCCTCACAGCCACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 265}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132999265_1132999272 15 Left 1132999265 16:2840948-2840970 CCGCTGGTGGTGGTCCCATGGTA 0: 1
1: 0
2: 0
3: 13
4: 121
Right 1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG 0: 1
1: 0
2: 2
3: 30
4: 265
1132999262_1132999272 17 Left 1132999262 16:2840946-2840968 CCCCGCTGGTGGTGGTCCCATGG 0: 1
1: 1
2: 0
3: 8
4: 129
Right 1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG 0: 1
1: 0
2: 2
3: 30
4: 265
1132999268_1132999272 1 Left 1132999268 16:2840962-2840984 CCCATGGTATGAGGAGTGGACCA 0: 1
1: 1
2: 0
3: 9
4: 58
Right 1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG 0: 1
1: 0
2: 2
3: 30
4: 265
1132999269_1132999272 0 Left 1132999269 16:2840963-2840985 CCATGGTATGAGGAGTGGACCAG 0: 1
1: 1
2: 0
3: 7
4: 117
Right 1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG 0: 1
1: 0
2: 2
3: 30
4: 265
1132999264_1132999272 16 Left 1132999264 16:2840947-2840969 CCCGCTGGTGGTGGTCCCATGGT 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG 0: 1
1: 0
2: 2
3: 30
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132999272 Original CRISPR GAGCCTCCTCACAGCCACCA AGG Intergenic
900001081 1:15219-15241 GAGCCACCTCCCAGCCACCTCGG + Intergenic
900020796 1:185740-185762 GAGCCACCTCCCAGCCACCTCGG + Intergenic
900343334 1:2199033-2199055 CAGCCTCCTCACAGCCTCAGTGG + Intronic
900634581 1:3656453-3656475 GTACCAGCTCACAGCCACCATGG - Intronic
900640880 1:3687586-3687608 GAGCATCCTGAGAGCCAGCAAGG - Intronic
900684683 1:3940556-3940578 GAGCCCTCTCCCTGCCACCATGG + Intergenic
900810871 1:4800526-4800548 GAGCTTCATCACGGCCTCCACGG + Intergenic
902620110 1:17645843-17645865 CTGCATCCTCACAGCCATCACGG - Intronic
903228552 1:21907591-21907613 GGGCCTCCTCAGAGCCTCCTAGG + Intronic
903809696 1:26028529-26028551 CAGCCTCCTCAGAGCCAGCCTGG - Intronic
904336352 1:29800699-29800721 CAGCCGAATCACAGCCACCAGGG - Intergenic
905466699 1:38159811-38159833 TACTCTCCACACAGCCACCAAGG - Intergenic
905930503 1:41783534-41783556 GGGCAACCTCACAGCTACCAGGG + Intronic
906693202 1:47806558-47806580 GGGCCTCCACACAGCCATCCAGG - Intronic
910211264 1:84795868-84795890 CTGCTTCCTCACAGCCAGCAAGG + Intergenic
910399294 1:86822606-86822628 GAGCCTCCTAACAGGCACTGTGG + Intergenic
912864888 1:113248137-113248159 GAGCCTCATCACTCCCTCCAGGG - Intergenic
914875803 1:151511991-151512013 GAGTCATCTCAAAGCCACCAGGG - Intronic
915366315 1:155318697-155318719 GGACCTCCTCACAGCCCCCCAGG + Exonic
915896558 1:159815631-159815653 GAACCTCCTCACAGTCGCTAAGG - Exonic
917859687 1:179134421-179134443 CAGCCTCCACGCAGCCTCCATGG - Intronic
921089759 1:211831046-211831068 GAGCCCCCTTTCAGCCAACACGG + Intergenic
923739206 1:236640318-236640340 GAGCTTTCTCACAGCTATCAGGG + Intergenic
1062832595 10:615910-615932 GAGCCTCCCTACAGGCACAAAGG - Intronic
1067443993 10:46329298-46329320 GGGCCTCCTCCTAGCTACCAGGG + Intronic
1069744422 10:70706151-70706173 GAGCCCCCCCACAGCATCCAAGG + Intronic
1070336107 10:75456305-75456327 GTGCCTCTTCACACCCAGCAAGG + Intronic
1071463573 10:85920527-85920549 GAGCCTCATCTCTGCCATCATGG + Intronic
1071728382 10:88222382-88222404 GAGCCTCCTCCCAGACTCCAAGG - Intergenic
1071803682 10:89093186-89093208 GTGCCTCTGCACAGCCACGATGG - Intergenic
1071983193 10:91024249-91024271 GTGCAGCCTCACAGCCAGCAAGG - Intergenic
1071984037 10:91032860-91032882 GGGTCTCCTCTCTGCCACCATGG - Intergenic
1072440091 10:95446775-95446797 GAGCCTCCTTAACTCCACCATGG + Intronic
1072690976 10:97572295-97572317 GACCCTCCTCACAGCCAGCAGGG + Intergenic
1075266828 10:121007621-121007643 TAGCCTCCTTACCCCCACCATGG - Intergenic
1075464499 10:122641573-122641595 TCCCCTCCTCTCAGCCACCAAGG - Intronic
1075676556 10:124299949-124299971 CAGCCTCCTGCCACCCACCAAGG + Intergenic
1076250642 10:128981344-128981366 GAAGCTCCTCACAGCCACCTTGG - Intergenic
1076338456 10:129726418-129726440 GAGCGTCCTCACAACACCCATGG - Intronic
1076704187 10:132292297-132292319 GGGTCCCCTCACTGCCACCAAGG + Intronic
1076747664 10:132522560-132522582 GAGGCTCCTTCCAGCCAACAGGG - Intergenic
1076842471 10:133052564-133052586 GAGCCTGCCTAGAGCCACCAGGG + Intergenic
1076903605 10:133351664-133351686 CAGCTTCCCCACAGCCTCCAGGG + Intronic
1077166304 11:1140997-1141019 GCGCCTCATTCCAGCCACCAGGG - Intergenic
1077183077 11:1225001-1225023 CTGCCTCCTCCCAGCCTCCATGG + Intronic
1077329583 11:1978152-1978174 GAGACACAGCACAGCCACCAGGG + Intronic
1077555887 11:3225854-3225876 GAGCCTGCTCTCAGCATCCAGGG - Intergenic
1077574996 11:3376198-3376220 CAGACTGCTCACAGCAACCATGG - Intronic
1078807803 11:14724048-14724070 GAGTCTCCCCATAGCCACTATGG - Intronic
1079109354 11:17595746-17595768 TTGCTTCCTCACAGCCAGCAAGG + Intronic
1080606464 11:33869072-33869094 GACGCTCCCCAAAGCCACCACGG - Intronic
1081909880 11:46694090-46694112 CAGCCTCCTCTCAGCAATCAGGG + Intronic
1082783416 11:57303475-57303497 CTGCCCCCTCCCAGCCACCATGG + Intronic
1083205892 11:61148950-61148972 GAGATTCCTCCCACCCACCAGGG + Intronic
1084203422 11:67577136-67577158 GAGCCTTCCCACACCTACCAGGG - Intergenic
1085419742 11:76345764-76345786 GAGACACCTCACAGCCACACAGG + Intergenic
1085772072 11:79334558-79334580 GAGGCTCCTCACAGCTGACAGGG + Intronic
1202812562 11_KI270721v1_random:33331-33353 GAGACACAGCACAGCCACCAGGG + Intergenic
1091374170 12:15334-15356 GAGCCACCTCCCAGCCACCTCGG + Intergenic
1091394549 12:145831-145853 GAGGCCGCTCACAGCCAGCATGG - Intronic
1091646498 12:2275917-2275939 CAGTCTCCCCACAGACACCAAGG - Intronic
1092819385 12:12339113-12339135 GAGCCTCTTCACAGCCTCTTTGG - Intronic
1096024652 12:48350680-48350702 GATCCTCCTCCCAGCCCCTATGG + Exonic
1103418266 12:120759354-120759376 CATCCCCCACACAGCCACCATGG - Intergenic
1103446378 12:120997622-120997644 GAGCCCCTTCATGGCCACCATGG + Exonic
1104383932 12:128332645-128332667 GAGCCTCCTCCCAGGTATCAGGG - Intronic
1104691430 12:130829353-130829375 CAGCCTCCTCACTGGCAACATGG - Intronic
1104749554 12:131229704-131229726 AAACCCCCTCACAGGCACCAAGG + Intergenic
1106581254 13:31020256-31020278 CAGCTTCATCACAGCCAGCAAGG + Intergenic
1106670131 13:31896480-31896502 GAGCCTCCTCAGCCCCTCCACGG - Intergenic
1113609720 13:111635527-111635549 GAGCGTCATCACAGCCAACACGG + Intronic
1113910919 13:113840860-113840882 GAGCCCTCTCTCAGCCAGCAGGG - Intronic
1115937489 14:38569957-38569979 GAGCCTCCTGAATGCAACCATGG - Intergenic
1118249622 14:64147034-64147056 TAGCCTTCTGACAGCCACCTTGG + Intronic
1119182202 14:72612850-72612872 CAGCCTCTGCACAGCCACCAGGG - Intergenic
1122843103 14:104476291-104476313 GAGTCTCCACAGAGCCCCCAAGG + Intronic
1123112986 14:105881729-105881751 CAGCTGCCTCACAGCCAGCAGGG + Intergenic
1123149900 14:106170649-106170671 GATGCTCCTCAGAACCACCAGGG - Intergenic
1123695359 15:22875174-22875196 GAGCCTGCTGACCCCCACCAGGG - Intronic
1123702501 15:22925970-22925992 GAGCATCCTCACCTCCACTAGGG + Exonic
1127493222 15:59484695-59484717 ATCTCTCCTCACAGCCACCACGG - Intronic
1127784243 15:62342161-62342183 GGGCCTCCTCACTGCAACCTGGG + Intergenic
1128079590 15:64848450-64848472 GAGCTTCCCCACAACCCCCAAGG - Intronic
1128512358 15:68321305-68321327 CATCCTCCTCACAGGCAGCATGG - Intronic
1128612544 15:69085456-69085478 AAGGCTCCCCAGAGCCACCAGGG + Intergenic
1129272031 15:74424080-74424102 GAGCATCCTCCCACCCACCAAGG + Intronic
1130127587 15:81106779-81106801 GAGCCACCACACAGCCACACTGG - Intronic
1132452428 15:101975721-101975743 GAGCCACCTCCCAGCCACCTCGG - Intergenic
1132454468 16:14901-14923 GAGCCACCTCCCAGCCACCTCGG + Intronic
1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG + Intergenic
1132999835 16:2843677-2843699 TAGCTTCCTCGCAACCACCAAGG + Intergenic
1133738732 16:8635269-8635291 TAGCATCATCGCAGCCACCATGG + Exonic
1134100940 16:11450896-11450918 GAGTCTCATCACAGCCGCAATGG + Intronic
1135903778 16:26491486-26491508 GAGCCTACTCAGGGCAACCATGG + Intergenic
1136187974 16:28599310-28599332 GTGACGCCTCACAGCTACCAAGG + Intergenic
1136190446 16:28612304-28612326 GTGACGCCTCACAGCTACCAAGG + Intronic
1136316564 16:29457919-29457941 GTGACTTCTCACAGCTACCAAGG - Exonic
1136431140 16:30197261-30197283 GTGACTTCTCACAGCTACCAAGG - Exonic
1136680154 16:31956143-31956165 GATGCTCCTCAGAACCACCAGGG + Intergenic
1136780496 16:32897687-32897709 GATGCTCCTCAGAACCACCAGGG + Intergenic
1136872044 16:33816487-33816509 GATGCTGCTCACAACCACCAGGG + Intergenic
1136889911 16:33961961-33961983 GATGCTCCTCAGAACCACCAGGG - Intergenic
1137396379 16:48118357-48118379 GAGCCCCCGCACAGCCGCCTTGG + Intronic
1138657780 16:58500843-58500865 GAGCCACCTCACAGTTCCCAGGG + Intronic
1139251486 16:65500662-65500684 GGGCCTCCTAACATCCACAATGG - Intergenic
1140076760 16:71707314-71707336 GAGTCTCCTCACAGGAACCAGGG - Intronic
1141792369 16:86245433-86245455 CAGCTTCTTCACAGCCAGCATGG + Intergenic
1142066389 16:88065364-88065386 GAGACTCCTCCCAGCCACAGAGG - Intronic
1142206573 16:88785627-88785649 GAGCCTCCCCACGGTCCCCAGGG - Intergenic
1203083123 16_KI270728v1_random:1161653-1161675 GATGCTCCTCAGAACCACCAGGG + Intergenic
1203100128 16_KI270728v1_random:1299581-1299603 GATGCTGCTCACAACCACCAGGG - Intergenic
1142897700 17:2992589-2992611 GAGCCATCTGCCAGCCACCAAGG - Intronic
1143708620 17:8718166-8718188 GAGCCTCCCCGCCGCCACCGTGG - Intergenic
1145012744 17:19378882-19378904 GAGTCTCCACACAGACACCATGG + Exonic
1145272064 17:21410073-21410095 AAGCTTCCTCACTGCCCCCAGGG + Intronic
1146658641 17:34650052-34650074 GAGCTGCCTCCCAGCCTCCATGG - Intergenic
1147262044 17:39214410-39214432 GTGTCCCCTCACAGCCCCCAGGG - Intronic
1148484147 17:47979819-47979841 GAGGCTCCTCCCAGCCTCAAGGG + Intronic
1148511488 17:48174271-48174293 GAGCCTACTTTCAGCCACCTGGG - Intronic
1148689419 17:49518452-49518474 TAGCTTCCACACAGCCTCCAAGG - Intergenic
1148812273 17:50301051-50301073 CAGCCTCCACACCACCACCAAGG - Intergenic
1148992969 17:51682352-51682374 CAGCCTCCTCACAGTGGCCAGGG - Intronic
1151537152 17:74745414-74745436 GAGCCTCCTCTCTGCCCCCTGGG - Exonic
1151892225 17:76957503-76957525 GATCCTATTCACAGGCACCAGGG - Intergenic
1152019745 17:77774440-77774462 CAGCCTCCTCCCAGCCTCCTGGG - Intergenic
1152291582 17:79442908-79442930 GAAGCTCCCCACAGCCACAATGG + Intronic
1152403785 17:80085046-80085068 GAGCCCCCTCAGATCCCCCACGG + Intronic
1155215516 18:23640195-23640217 GAGAGTGCTGACAGCCACCAGGG + Intronic
1155281288 18:24242509-24242531 GCTCCTCCCCACAGCCCCCAAGG + Intronic
1155335715 18:24763534-24763556 GAGCCCCCATACAGCCACCACGG - Intergenic
1160374141 18:78398175-78398197 GAGCCCCTGCCCAGCCACCATGG + Intergenic
1160426205 18:78780959-78780981 GATCCTTATCACAGCAACCACGG + Intergenic
1160439216 18:78876225-78876247 GCGCCTGGCCACAGCCACCAAGG + Intergenic
1160854720 19:1211557-1211579 GAGCCTCCGCAGAGGCACCCAGG + Intronic
1161416936 19:4152616-4152638 GAGACACCTCTCAGCCACCCGGG + Intergenic
1161468546 19:4445299-4445321 GCGCATCCCCACAGCCCCCAAGG + Exonic
1162390424 19:10386416-10386438 GGGCCTCCTCAGAGCCCCCTGGG + Intergenic
1164839314 19:31380629-31380651 CAGCCTCCTCTCAGCAACCACGG - Intergenic
1167270589 19:48503566-48503588 CAGCCTCCTCCCAGCCTCCCTGG + Intronic
1167492177 19:49799230-49799252 GACCCATCTCACAGCCCCCAAGG - Intronic
925085199 2:1102309-1102331 CAGCCTCCTCACAACAGCCAGGG - Intronic
926104794 2:10143338-10143360 GGGCCTCCTCAGAGCCCTCATGG + Intronic
927523618 2:23718321-23718343 TAGCCTCCTCACAGCAACAGTGG + Intergenic
927894679 2:26774186-26774208 GAGCCTCTTCACTAGCACCAGGG + Intronic
928263194 2:29786368-29786390 AAGCCTCTGCACAGCCATCAGGG + Intronic
930165182 2:48197397-48197419 GAGGCTGCACACAGGCACCAAGG + Intergenic
930887686 2:56346487-56346509 GAGCCTCTGTACAGCCACCGTGG + Intronic
931776514 2:65545682-65545704 GAGCCACTGCCCAGCCACCAAGG + Intergenic
934937933 2:98478631-98478653 GACCCTCTTCACAGCCACATTGG - Intronic
936568641 2:113598195-113598217 GAGCCACCTCCCAGCCACCTCGG - Intergenic
937454814 2:122032094-122032116 CAGCCTCCCCAGAGCCACCAGGG + Intergenic
937997625 2:127706885-127706907 CTGCCTGCTCCCAGCCACCAGGG + Intronic
938086419 2:128405041-128405063 GAGCCCCAGCACAGCCACCACGG - Intergenic
938101554 2:128501166-128501188 GAGCCTCCTCACCCACTCCAGGG - Intergenic
938949821 2:136245707-136245729 CAGTCTCCTCACAGACATCAGGG - Intergenic
939279611 2:140045281-140045303 ATGTCTCCTCACATCCACCAGGG + Intergenic
944260713 2:197673217-197673239 AAGCCTCCTCCCAGCAACCCAGG + Intronic
944385054 2:199154807-199154829 GAACCTCCTCCCCGCAACCAAGG + Intergenic
945814434 2:214586959-214586981 CAGTATCCTCACTGCCACCAAGG + Intergenic
947118460 2:226795645-226795667 GAGCCTGCCCAGGGCCACCATGG - Exonic
947846165 2:233245540-233245562 TAGCCTCCCCACCTCCACCACGG + Intronic
1169791616 20:9415901-9415923 CTGCACCCTCACAGCCACCAGGG + Intronic
1170909416 20:20549834-20549856 AACCTTCCTCACAGCCTCCAGGG + Intronic
1170959418 20:21012037-21012059 GAGCCTGCTCACAGCCCTGAAGG - Intergenic
1171277695 20:23872336-23872358 GAGCCTCCTCACATTCAGGAAGG + Intergenic
1172563045 20:35906391-35906413 GAGCCTGAGCACAGCCACCATGG - Intronic
1172647118 20:36477517-36477539 CAGGCTCCTCAAAGCCACCAGGG - Intronic
1174035455 20:47665814-47665836 GAGCATGCTCTCGGCCACCACGG - Intronic
1175175288 20:57108201-57108223 AAGCCACCCCCCAGCCACCATGG + Intergenic
1175719824 20:61279349-61279371 GAGCCTCCTCCCAGGCAGCAAGG + Intronic
1175815507 20:61881303-61881325 GAGCCTCCTCTCAGACTCCATGG - Intronic
1176187706 20:63790257-63790279 GATGCTCCTCCCAGCCATCACGG + Exonic
1176334618 21:5584375-5584397 GAGCATCCTCAAAGTCATCAGGG - Intergenic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176393139 21:6236573-6236595 GAGCATCCTCAAAGTCATCAGGG + Intergenic
1176468280 21:7079601-7079623 GAGCATCCTCAAAGTCATCAGGG - Intronic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491841 21:7461379-7461401 GAGCATCCTCAAAGTCATCAGGG - Intergenic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1176508801 21:7677004-7677026 GAGCATCCTCAAAGTCATCAGGG + Intergenic
1179481493 21:41681538-41681560 GAGCCTCCTCCCAGCTGCCCTGG - Intergenic
1179519175 21:41931198-41931220 GAGCCTGCTCACAGCAGCCGTGG + Intronic
1179553854 21:42160231-42160253 CCCCCGCCTCACAGCCACCAGGG - Intergenic
1179955427 21:44735625-44735647 GAGCCTCCACACAGGCAGCGAGG + Intergenic
1180079102 21:45478162-45478184 GAGCCTCCTCACACCCACAAGGG - Intronic
1180831004 22:18906136-18906158 AACCCTCCTTGCAGCCACCACGG + Intronic
1182445965 22:30389868-30389890 AAGCCTCTTCACGGGCACCACGG - Intronic
1183714342 22:39525047-39525069 GACCCTCCTCACAGCCTCTCAGG - Intergenic
1183937727 22:41273171-41273193 TTGCCTGCTCACAGCAACCAGGG - Intronic
1184567200 22:45299156-45299178 CAGCCTGCTCACAGCCAACAGGG + Intergenic
1184900717 22:47444898-47444920 GAGCCTCCTAGCACCCAACAGGG + Intergenic
1185058881 22:48595226-48595248 GTGCCTCCTCCCAGGCTCCATGG - Intronic
1203281091 22_KI270734v1_random:131407-131429 AACCCTCCTTGCAGCCACCACGG + Intergenic
949890583 3:8730935-8730957 GAGCCTCCTTACACACACCAAGG + Intronic
950482469 3:13253062-13253084 AAGCAACCTCACACCCACCAGGG - Intergenic
952738133 3:36710441-36710463 AAGCTTCCTCAAAGCCAGCAGGG + Intergenic
953020532 3:39110241-39110263 CAGCATCTGCACAGCCACCAGGG - Intronic
954199420 3:49015321-49015343 GGGCCTGCTCACAGACAGCATGG + Exonic
955007791 3:54986027-54986049 GTTCCTCCTCCCAGCCAACAGGG - Intronic
961210420 3:125120884-125120906 GAGCCTCCTCCAACCCACAAAGG - Intronic
961454113 3:127015897-127015919 TAGTCTCCTCACAGCCCCCTGGG + Intronic
965496831 3:169408918-169408940 CAGTCTCCTCACAGCTAGCATGG + Intronic
966498164 3:180604246-180604268 GTGCCTTCTCACAGTAACCATGG + Exonic
967729098 3:192890780-192890802 GATCCTCCTCACATCCTCCATGG + Intronic
967986066 3:195096105-195096127 CAGCCTTCTCCCAGCCGCCACGG + Intronic
968747629 4:2369008-2369030 CGGCCACTTCACAGCCACCAGGG - Intronic
968869940 4:3236662-3236684 CACCCTGCTCACAGGCACCACGG - Intronic
968895714 4:3401931-3401953 GAGCCTCTCCACAGTCAGCAAGG + Intronic
968910753 4:3475961-3475983 GGCACTCCTCACAGCCACGAGGG - Intronic
972541532 4:40043444-40043466 CAACCTCGTCACAGCCTCCATGG - Intergenic
973200948 4:47501601-47501623 GAGCCCTCTGATAGCCACCAAGG + Intronic
973744168 4:53947012-53947034 GAGCTTTCTCATGGCCACCACGG - Intronic
979350283 4:119636504-119636526 TAGCTTCCTCAAAGCCAGCAAGG + Intergenic
979584870 4:122403981-122404003 CAGCCCCCACACAGCCAACAAGG + Intronic
981078858 4:140618317-140618339 CAGCATCCTCACCCCCACCAAGG - Intergenic
981548791 4:145921403-145921425 CAGTCTCCACACTGCCACCATGG - Intronic
983205702 4:164908613-164908635 GTGCCTCCTGACATACACCAGGG + Intergenic
983416135 4:167457451-167457473 GAGACTCTTCACAGGCAGCAAGG - Intergenic
985784818 5:1887978-1888000 GAGCCTGGTCCCAGCCGCCAGGG + Intergenic
987833974 5:23136997-23137019 CAGCATCCTCAAAGCCAGCAAGG - Intergenic
992645622 5:78808515-78808537 CAGCATCCTCCCAGCCACCCAGG - Intronic
995214662 5:109581713-109581735 GTGGCTCCTTACAGCCATCATGG + Intergenic
995740429 5:115350351-115350373 GAGTCTCTTCCCAGCTACCAGGG + Intergenic
996688422 5:126310516-126310538 GGGCCCCCTCACAGACACCAAGG - Intergenic
997662928 5:135603421-135603443 GACACTCCTCAAAGCCAGCATGG - Intergenic
999702997 5:154245194-154245216 GCCCATCCTCACTGCCACCATGG - Intronic
1001549549 5:172593313-172593335 GGGCCTCCTCTCAGCAGCCAGGG - Intergenic
1002284853 5:178155219-178155241 GAGCCCCCTCTCAGCCTCCCGGG - Intergenic
1002758055 6:179867-179889 GAGCCTCCCCCCAGCCGCCGTGG + Intergenic
1005946855 6:30601924-30601946 GAGCATCCTCACCTCCTCCATGG + Exonic
1006359503 6:33579525-33579547 GAGCCTCAGAACACCCACCAAGG + Intronic
1006931002 6:37688492-37688514 AAGCCACCACCCAGCCACCAAGG + Intronic
1009269286 6:61598111-61598133 CAGACTCCTCACAGTCAGCAGGG - Intergenic
1011928035 6:92672710-92672732 GATCCTCCGCCCAACCACCATGG + Intergenic
1013632167 6:111996225-111996247 AAGCCTCCTCACAGAAGCCACGG + Intergenic
1017021579 6:150143732-150143754 AACCCTCCCCACGGCCACCAAGG - Intronic
1017717464 6:157222732-157222754 GAGCCTCCTCCCAGCCCTCCTGG + Intergenic
1018385113 6:163296057-163296079 GAGTCTCCTAACACCCCCCAGGG - Intronic
1019708753 7:2508843-2508865 GAGACTCCTCTCAGCCTCCCTGG - Intergenic
1021510529 7:21428135-21428157 CAGCCTCCTCCGAGCCACCGCGG + Exonic
1021981052 7:26055955-26055977 GAGCATCTGCACAGCCAGCAAGG + Intergenic
1024048196 7:45599582-45599604 AAACCTCCTCACAGCCCCCGAGG - Intronic
1026559554 7:71436965-71436987 TGGGCTCCTCACAGACACCAAGG + Intronic
1028028367 7:85875699-85875721 GAGCTCCCACACAGCCAGCAAGG - Intergenic
1031056501 7:116998084-116998106 GAGCCTCCCCCCTGCCTCCATGG - Intronic
1032519607 7:132534005-132534027 CAGCCTTCACTCAGCCACCAAGG - Intronic
1034443786 7:151101483-151101505 CAGCCTCTTCCCAGCCACCTGGG - Intronic
1034489904 7:151387560-151387582 GAGACTCCTCAGAGCCGCCGTGG - Intronic
1034900198 7:154903530-154903552 CAGCCTCCTGCCAGTCACCACGG + Intergenic
1035025421 7:155821891-155821913 GAGCACCCTCTCAGCCACCCTGG - Intergenic
1035451261 7:158978410-158978432 GTGCCACCTCACAGCCATTAGGG - Intergenic
1035796969 8:2366722-2366744 CTGCCTCCTCAGAGCCACCGGGG - Intergenic
1038018613 8:23534753-23534775 AACCCTCCTCACAACCACCCTGG - Intronic
1038112465 8:24514462-24514484 GTGCCTCCTCAGGTCCACCAGGG + Intronic
1038546373 8:28428606-28428628 CAGCATCCTCACAGGCACCCTGG - Exonic
1038593740 8:28866493-28866515 GAGCTTCCTTACAGACCCCAGGG + Intronic
1039558746 8:38496103-38496125 GAGCCACCTCACCGGCCCCAGGG - Intergenic
1040392524 8:46962031-46962053 GAGGCCCCTCACTGCCAGCAAGG + Intergenic
1041706029 8:60847174-60847196 GAGCCTACTCACGGCCAGCATGG - Intronic
1041716938 8:60941039-60941061 GAGACTCCAAAGAGCCACCATGG - Intergenic
1042307106 8:67343592-67343614 GGGCTCCCTCACCGCCACCAGGG - Exonic
1042564844 8:70101115-70101137 GAGCCCCGTCTCTGCCACCATGG + Intergenic
1046259007 8:111741356-111741378 CAGGCTCCTCCCAGCCACAAAGG - Intergenic
1046661170 8:116949840-116949862 GAGCCTCCTCCCAACCCCCGCGG - Intergenic
1047959765 8:130002668-130002690 AAGTCTCCTCACAGCCTCCATGG + Intronic
1048004898 8:130411292-130411314 GAGCTTGCTCTCAGCCACCAAGG + Intronic
1048865842 8:138760934-138760956 CAGCGTCCTCACAGACCCCAGGG + Intronic
1049219187 8:141421139-141421161 TAGCCACCACACAGCCAGCAGGG - Intronic
1049449897 8:142654980-142655002 AGGCCTCCTCAAAGCCACCTTGG - Intergenic
1049883886 9:15330-15352 GAGCCACCTCCCAGCCACCTCGG + Intergenic
1050622405 9:7468041-7468063 GAACGTCCACAAAGCCACCAAGG + Intergenic
1055461093 9:76520952-76520974 GAGCCACCACACAGCCAGCCAGG + Intergenic
1056974604 9:91240333-91240355 GAGACCTCTCAGAGCCACCAGGG - Intronic
1057553222 9:96067255-96067277 CGGCCTCCACACAGCCTCCAAGG + Intergenic
1057691961 9:97293436-97293458 CAGCCCCCTCACTGCCCCCAGGG - Intergenic
1057910357 9:99015521-99015543 GGCTCCCCTCACAGCCACCATGG + Exonic
1058529045 9:105887922-105887944 GACTCTCCCCACAGCCCCCAAGG - Intergenic
1059549435 9:115214116-115214138 TCTCCTCCTCCCAGCCACCAGGG - Intronic
1060790579 9:126483025-126483047 GAGCCTCCGCGAAGCCAGCAGGG - Intronic
1061404131 9:130384352-130384374 GACTATCCCCACAGCCACCACGG - Intronic
1061448922 9:130658471-130658493 GAGAGACCTCAGAGCCACCAGGG + Intergenic
1062100333 9:134724719-134724741 AAGCCACGTCACAGCCACCGCGG + Intronic
1062192353 9:135254535-135254557 GGGCATCCTCTCAGCCACCCTGG - Intergenic
1062379174 9:136278546-136278568 TTGCATCCTCACAGCTACCAGGG - Intergenic
1203427013 Un_GL000195v1:50546-50568 GAGCATCCTCAAAGTCATCACGG + Intergenic
1185772411 X:2774495-2774517 GGGCATCCTCACAGCCTCAAGGG + Intronic
1186245826 X:7616077-7616099 GAATCTCCTCAAAGCCACCCAGG + Intergenic
1187963706 X:24590215-24590237 GGACCTGCTCACAGCCACCCTGG + Intronic
1188951069 X:36375934-36375956 AAGGGTCTTCACAGCCACCATGG - Intronic
1189023782 X:37370547-37370569 CAGCCTGCTCCCAGCCCCCAAGG - Intronic
1189363415 X:40370405-40370427 GAGAGGCCCCACAGCCACCAAGG - Intergenic
1198478434 X:137018037-137018059 GAGTCTTTCCACAGCCACCATGG - Intergenic
1198483126 X:137059168-137059190 GAGCTTCCTCACTGGCACAAAGG + Intergenic
1199729431 X:150616655-150616677 AAGACTCCACACAGGCACCAGGG - Intronic
1200401925 X:156024829-156024851 GAGCCACCTCCCAGCCACCTCGG - Intergenic
1201464323 Y:14263930-14263952 GAATCTCCTCAAAGCCACCTAGG + Intergenic