ID: 1133000229

View in Genome Browser
Species Human (GRCh38)
Location 16:2846990-2847012
Sequence TTATGTTAGGGGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133000229_1133000240 17 Left 1133000229 16:2846990-2847012 CCCTCCTCCTTCCCCTAACATAA No data
Right 1133000240 16:2847030-2847052 ATTAACTTAAGGTGGTTCTTTGG No data
1133000229_1133000238 6 Left 1133000229 16:2846990-2847012 CCCTCCTCCTTCCCCTAACATAA No data
Right 1133000238 16:2847019-2847041 CCTGAAATTCTATTAACTTAAGG No data
1133000229_1133000239 9 Left 1133000229 16:2846990-2847012 CCCTCCTCCTTCCCCTAACATAA No data
Right 1133000239 16:2847022-2847044 GAAATTCTATTAACTTAAGGTGG No data
1133000229_1133000241 18 Left 1133000229 16:2846990-2847012 CCCTCCTCCTTCCCCTAACATAA No data
Right 1133000241 16:2847031-2847053 TTAACTTAAGGTGGTTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133000229 Original CRISPR TTATGTTAGGGGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr