ID: 1133001814

View in Genome Browser
Species Human (GRCh38)
Location 16:2855727-2855749
Sequence CCTTCCAGGAATACACAGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133001808_1133001814 4 Left 1133001808 16:2855700-2855722 CCAGGGCAATGTCTGCACAGGCA 0: 1
1: 0
2: 1
3: 16
4: 159
Right 1133001814 16:2855727-2855749 CCTTCCAGGAATACACAGGGTGG 0: 1
1: 0
2: 2
3: 20
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133001814 Original CRISPR CCTTCCAGGAATACACAGGG TGG Exonic
900308962 1:2024383-2024405 CCTCCCAGGAAGGCCCAGGGTGG - Intronic
902210246 1:14899737-14899759 CCTTACAGGAACCCATAGGGAGG - Intronic
902841475 1:19076874-19076896 CCTACCAGTAACACAGAGGGAGG - Exonic
903439793 1:23379103-23379125 CCTTCCAGGAAGTCACAGCCTGG - Intergenic
905007503 1:34721769-34721791 GTTTCCAGGAATACACTGTGTGG + Intronic
909344893 1:74573195-74573217 CCCTCCAGGCATAGAAAGGGGGG - Exonic
911681383 1:100719785-100719807 CCTCCCAGGCACACACAGGTGGG + Exonic
912874117 1:113339185-113339207 CCTTGGAGGAAGACACAGGAGGG + Intergenic
915597249 1:156902630-156902652 CATTCCAGAGATACTCAGGGGGG + Intronic
916207786 1:162332120-162332142 CATTCAAGGAACACCCAGGGAGG - Intronic
917509506 1:175658529-175658551 CTGGCCAGGAACACACAGGGAGG + Intronic
921633329 1:217461432-217461454 CCTTCAAGGAATATACAGTCTGG - Intronic
921933225 1:220772555-220772577 CCTTGCAGGCAGACACAGTGAGG - Intronic
924385166 1:243493084-243493106 CCCTCCCGGAATACAGAGTGTGG - Intronic
1063961279 10:11307341-11307363 CCTTGCAGGAAATCACAGGAGGG - Intronic
1064731832 10:18339097-18339119 CCTCACATGAGTACACAGGGAGG - Intronic
1073762382 10:106644032-106644054 CCTTGCAGGTAAACACAGGGTGG + Intronic
1075810623 10:125222323-125222345 CCTTCCAGGAAGAAACACGAGGG - Intergenic
1076329177 10:129652401-129652423 CCTTCCTGGAAGGCAAAGGGAGG + Intronic
1076501686 10:130942149-130942171 CCTCCAAGGCATAGACAGGGCGG + Intergenic
1078039653 11:7848088-7848110 CCTTCAATGAATGCACAGGCTGG - Intergenic
1079451490 11:20602947-20602969 CCTTCCAGGGCTGCAAAGGGTGG - Intronic
1081854274 11:46294305-46294327 TCTGCCAGGAAGACTCAGGGAGG + Intronic
1083308344 11:61772238-61772260 CCTTCCTGGAATGCAGAGGGAGG - Intronic
1084894940 11:72259282-72259304 CCTATAAGGAATACAAAGGGAGG - Intergenic
1085627386 11:78083773-78083795 TCGTCCAGGAATAGTCAGGGTGG - Intergenic
1086848914 11:91785205-91785227 CCATCCTGGAATAAAAAGGGAGG + Intergenic
1087470686 11:98570439-98570461 CCTCCCTGGAATTCACAGTGTGG + Intergenic
1090834206 11:130442114-130442136 CCTTACAAAAATACTCAGGGAGG - Intergenic
1092194556 12:6541464-6541486 CCTTCCAGGGGGACACAGCGGGG - Intronic
1100889420 12:99107801-99107823 ACTCCCAGAAAGACACAGGGAGG + Intronic
1101740094 12:107494042-107494064 CCTAACAGCACTACACAGGGAGG + Intronic
1102915960 12:116752322-116752344 ACTTCTAGGAATAGAAAGGGTGG - Intronic
1103188266 12:118980313-118980335 CCTTCCAGGAATTTACAGCCTGG + Intergenic
1103402708 12:120654287-120654309 CCTTCCAGGCCTAGAGAGGGTGG - Intronic
1106243544 13:27928279-27928301 CCTTCCAGGGAGGCCCAGGGAGG + Intergenic
1113937556 13:114002396-114002418 CATTCCAGGGATTCACAGGCAGG + Intronic
1114043247 14:18699527-18699549 CCATCCAGGAAAACACTGGCTGG + Intergenic
1114047538 14:18889973-18889995 CCATCCAGGAAAACACTGGCTGG + Intergenic
1114114985 14:19511672-19511694 CCATCCAGGAAAACACTGGCTGG - Intergenic
1114116676 14:19629435-19629457 CCATCCAGGAAAACACTGGCTGG - Intergenic
1114885642 14:26846606-26846628 CCTTGCAGACAGACACAGGGGGG + Intergenic
1116951325 14:50881310-50881332 CCTGCCAGAAAAAGACAGGGAGG - Intronic
1118813090 14:69289631-69289653 CCTTCCAGGAAGACTCCTGGTGG - Intronic
1119644958 14:76341411-76341433 GCTTCCAGGAGGCCACAGGGAGG - Intronic
1119926407 14:78498461-78498483 TCTTCCTGGAATACACAGAAAGG - Intronic
1121835611 14:97089385-97089407 GCTTCAAGGAATACACAGGGAGG + Intergenic
1122548009 14:102535466-102535488 CCTTGCAGGAAGGAACAGGGTGG - Intergenic
1123023540 14:105413063-105413085 CCTTCCAAGATTACACAGCCAGG + Exonic
1128241894 15:66107059-66107081 CCCACCAGGTATAGACAGGGAGG + Intronic
1129852481 15:78801637-78801659 CCTTCCTAGACTACACTGGGAGG - Intronic
1130579275 15:85120879-85120901 ACTTCCAGCATTACACAGGAAGG - Exonic
1131984880 15:98033135-98033157 CCTTCCAGGAACTCACAGCTTGG + Intergenic
1133001814 16:2855727-2855749 CCTTCCAGGAATACACAGGGTGG + Exonic
1133495589 16:6314310-6314332 CCTTCCAGAAATTCACAGCCTGG + Intronic
1136450525 16:30352064-30352086 CCTTCCAGGAATTCAGAGTCTGG - Exonic
1137565259 16:49528748-49528770 CCATCCAGGAAAACAGGGGGAGG + Intronic
1137836368 16:51596467-51596489 CCTTCTAGGATCACACAGTGAGG + Intergenic
1140403564 16:74691912-74691934 CCTTCCAGGAGCTCACGGGGTGG - Intronic
1141209905 16:81968581-81968603 GCTTCCAAGAATACACAGTGGGG - Intergenic
1141840294 16:86569598-86569620 TCTTTTAGGAATACTCAGGGTGG - Exonic
1142579480 17:932551-932573 CCTTCTAAGAAAACACAGGCTGG + Intronic
1148196822 17:45720007-45720029 CCTCCCAGGAAACCACAGTGTGG + Intergenic
1151227171 17:72655996-72656018 CCTTGCAGGAATGCACAGCAGGG - Intronic
1153113861 18:1630352-1630374 AGTACCAAGAATACACAGGGAGG + Intergenic
1153968950 18:10207173-10207195 AGTTCCAGGAATAGACAGGCAGG + Intergenic
1159168290 18:64730107-64730129 CCTTCAAGAAATTCTCAGGGAGG - Intergenic
1160067258 18:75587262-75587284 ACTCCCATAAATACACAGGGTGG + Intergenic
1160981223 19:1817483-1817505 CTTGCCAAGAAGACACAGGGAGG + Intronic
1168312478 19:55467908-55467930 CCGGCCAGCAATGCACAGGGCGG + Intergenic
1168382242 19:55933641-55933663 CCTTTCAGGTATAAGCAGGGAGG + Intergenic
925058708 2:874644-874666 CCTTCCCGGAACACCCAGGCAGG + Intergenic
927151305 2:20198065-20198087 CCCTCCAGGAGCACCCAGGGTGG + Intergenic
928229413 2:29483736-29483758 TCTAAGAGGAATACACAGGGAGG - Intronic
931530967 2:63213903-63213925 CCTCCCAAGAATACACCAGGAGG + Intronic
931827454 2:66016526-66016548 CCACCCAGGAAAACACAGTGAGG - Intergenic
932793417 2:74674870-74674892 CCTCCCTGGAATTCACAGGTTGG - Exonic
933029786 2:77313474-77313496 ACTCCCAGGAAAACATAGGGAGG - Intronic
933119237 2:78515580-78515602 CTTTCCAGAAATAAACAGGAAGG + Intergenic
933630794 2:84654910-84654932 GATTCCAGGAATTCACAGGGAGG - Intronic
933749008 2:85591274-85591296 CCTGGCTGGAACACACAGGGAGG - Intronic
933787966 2:85858860-85858882 CCTTCCATGATTCCTCAGGGAGG + Intronic
934103369 2:88674258-88674280 GCTTCCAGGAATACAGCAGGGGG - Intergenic
935622210 2:105139956-105139978 CCATCCAGGGGTCCACAGGGAGG + Intergenic
935657666 2:105438708-105438730 TTTTCCAGGAATCCAAAGGGTGG + Intergenic
937165291 2:119808617-119808639 CCAGCCTGGAAAACACAGGGAGG - Intronic
938069931 2:128302984-128303006 CTTTGGAGGAACACACAGGGAGG - Intronic
938424914 2:131178495-131178517 CCATCCAGGAAAACACTGGCTGG + Intronic
938682790 2:133709339-133709361 CACTCAAGGAATACACGGGGTGG + Intergenic
940365196 2:152840553-152840575 CATTCAAGGAATAAAAAGGGGGG - Intergenic
942398222 2:175574551-175574573 CCTTCCAGGCATGTGCAGGGAGG - Intergenic
942519684 2:176790699-176790721 ACTCCCAGGAATTCACTGGGAGG - Intergenic
946372315 2:219288293-219288315 CCTTCTGGGACTATACAGGGTGG + Intergenic
948627054 2:239275792-239275814 CCTTCCAGGAGCTCACAGGGAGG + Intronic
1170871892 20:20213505-20213527 CCTCCCAGGAATTCCCAGGGAGG + Intronic
1171034539 20:21705100-21705122 CCTGTCAGGAAGACACAAGGCGG - Intergenic
1172307998 20:33895366-33895388 CCTTAAATGAAGACACAGGGTGG + Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1172819883 20:37722442-37722464 CCATCCAGGAAGACAGAGTGAGG + Intronic
1173576666 20:44116386-44116408 CCTGCCAGGGCAACACAGGGAGG + Exonic
1174367380 20:50064708-50064730 CCTCCCAGGCACACACAGAGGGG + Intergenic
1175729617 20:61345517-61345539 CCTTTATGGAATACCCAGGGTGG + Intronic
1178180754 21:30158491-30158513 CTTTCCAGGGATACACAGCAAGG - Intergenic
1178404031 21:32310253-32310275 CATTCCTGGAATGCTCAGGGCGG + Intronic
1180089920 21:45528632-45528654 CCTTCCAGGAATCCACCTGAGGG + Intronic
1180466071 22:15612644-15612666 CCATCCAGGAAAACACTGGCTGG + Intergenic
1181401040 22:22650495-22650517 GCTTCCAGGACTACAGCGGGTGG + Intergenic
1181713495 22:24706827-24706849 ACTTCCAGGCATATACATGGGGG + Intergenic
1182182868 22:28369999-28370021 GCTTCCTGGTATACAGAGGGAGG - Intronic
1183443873 22:37839934-37839956 CCATCAAGGAGTCCACAGGGTGG + Intronic
1183505599 22:38207055-38207077 CCTGCCAGGGCCACACAGGGAGG + Intronic
1183819230 22:40331517-40331539 TCATTCAGGAAGACACAGGGAGG + Exonic
1184074371 22:42166816-42166838 CATTCCAGGAATACGCATCGTGG + Intronic
1184119143 22:42439041-42439063 GCTTCCAGGAGTAGACAGGAGGG + Intergenic
1184450330 22:44578707-44578729 CCTCCCAGGAATCCCCAGGCTGG - Intergenic
1184930265 22:47675588-47675610 CCTTCCCGGAAGACAGAGGAGGG + Intergenic
954099150 3:48355955-48355977 CCTTCCATGAATACTAAGGGTGG + Intergenic
954527419 3:51284337-51284359 CCTTCCAGGGAGAAACAGGGAGG - Intronic
956284086 3:67590260-67590282 ACTTGCTGGAATACACAGGGAGG - Intronic
960086759 3:113599582-113599604 CCTTCCATGGATAAACATGGAGG + Intronic
963586091 3:147190847-147190869 GCTTCCAAGAATACACAGTGGGG - Intergenic
966978056 3:185103867-185103889 CCTTTCAGGCATATACATGGTGG + Intronic
968867554 4:3223398-3223420 CCTTCCAGGAAGACACAGAGAGG + Exonic
969251446 4:5971061-5971083 CCTTCCAGGAATACCCCTGGAGG - Intronic
973179895 4:47254320-47254342 TCTTCCTGGAATATACATGGTGG + Intronic
974099002 4:57396420-57396442 CATTCCATGAATACACACTGAGG + Intergenic
974610462 4:64209245-64209267 CTTTTCAGGCATATACAGGGTGG + Intergenic
980291921 4:130855299-130855321 CCTTCCTGGAACAGAAAGGGAGG + Intergenic
980690320 4:136288546-136288568 CCTTCCAGGAATAAACTCGGGGG - Intergenic
982340039 4:154287024-154287046 CCTTACAGGAAAAGAGAGGGTGG + Intronic
984575576 4:181444202-181444224 CCTTCCAGGAACACACTGGTTGG + Intergenic
985709399 5:1419870-1419892 CCTCCCAGGAAGCCCCAGGGAGG - Intronic
988819431 5:34866608-34866630 GCTTCCAGGAATTCACAAGATGG - Intronic
990061269 5:51651730-51651752 TCTTCCAGGAGTACACAGAGTGG + Intergenic
990361743 5:55027754-55027776 TCTTCCAGGAAAGCTCAGGGTGG + Intronic
993371953 5:87103477-87103499 CCCCCCAGGAAAACACTGGGAGG - Intergenic
997225997 5:132209981-132210003 CCATGCAGGACTACACAGGGTGG - Intronic
997251391 5:132391411-132391433 CCTTCTAGGAATACAAATGAAGG + Intronic
997369721 5:133350796-133350818 CCTTCCAGGCAGTGACAGGGAGG + Intronic
999616777 5:153433184-153433206 CCTGCCAGGAATTAACTGGGTGG + Intergenic
1000859284 5:166437070-166437092 CATTCCAGGAATTCACAGTGTGG + Intergenic
1001169400 5:169404468-169404490 CCTTCCATGAATACAAGGGAAGG + Intergenic
1001564526 5:172690836-172690858 CCTGCCAGGGAGACACAGTGAGG + Exonic
1002631981 5:180588398-180588420 CTTTCCAGGAAAACAACGGGGGG - Intergenic
1002994127 6:2267067-2267089 GCTTCCAGGAATATAGAGTGAGG - Intergenic
1010320690 6:74505190-74505212 CCTTCCAGGAATTTAAAGAGGGG - Intergenic
1011723051 6:90178839-90178861 TCTCCCAGGAACACACTGGGTGG - Intronic
1016993827 6:149947225-149947247 CCTTCCAGGATGACCTAGGGTGG + Intronic
1017004506 6:150020312-150020334 CCTTCCAGGATGACCTAGGGTGG - Intronic
1020868088 7:13591212-13591234 CCTCACAGGAATTCCCAGGGTGG + Intergenic
1023545340 7:41312481-41312503 CCCTCCTGGAACTCACAGGGTGG - Intergenic
1026475272 7:70729439-70729461 CCTACCTGGAATCCCCAGGGGGG + Intronic
1030296528 7:107934441-107934463 CCTTCCTTGAAAACACAGGAAGG + Intronic
1030308685 7:108046960-108046982 CCTGCCTGGGAAACACAGGGAGG - Intronic
1032563553 7:132916967-132916989 CATTTCAGGCATCCACAGGGGGG + Intronic
1032793327 7:135258400-135258422 GCTTCCTGCAAGACACAGGGTGG - Exonic
1034904259 7:154929931-154929953 GCTCCCAGGTATATACAGGGGGG + Intronic
1035056993 7:156042353-156042375 CCTGCCTTGACTACACAGGGTGG + Intergenic
1039020997 8:33206437-33206459 CATTCCTGGAATACAAATGGAGG - Intergenic
1042395963 8:68292547-68292569 CCTCCCATGAGAACACAGGGAGG - Intergenic
1043657301 8:82684859-82684881 GGTTCTAGGAATACACAGGGTGG + Intergenic
1049379190 8:142303531-142303553 CTTTCCAGGAACACCCATGGGGG + Intronic
1049427775 8:142544932-142544954 CCCTCCAGGAAGAAGCAGGGGGG + Exonic
1050910230 9:11059088-11059110 CTTGTCAGGAATACACAGGTTGG - Intergenic
1051685852 9:19657551-19657573 TGTTCAAAGAATACACAGGGAGG - Intronic
1051915655 9:22203912-22203934 CATTTCAAGAATAAACAGGGAGG + Intergenic
1052218999 9:25997471-25997493 CATTCCAGGAATAGTCAGGGAGG - Intergenic
1052815528 9:33100105-33100127 CCTTCCAGGAAAACACGCAGAGG + Intergenic
1056074494 9:83024584-83024606 CCTTCCAGGAGGATAAAGGGTGG - Intronic
1056477226 9:86964369-86964391 CCTTCCAGAAATCCACATGATGG + Intergenic
1060975254 9:127761484-127761506 CCTCCTGGGAATACACAGTGAGG + Intronic
1061043031 9:128150652-128150674 CCTTCCATGAAGGCACTGGGTGG - Intronic
1062264993 9:135682957-135682979 CCTCCCAGAAATGCACAGAGGGG - Intergenic
1186230621 X:7449836-7449858 CCTTCCAGGCATACCCAGCCTGG + Intergenic
1197171770 X:123442989-123443011 CCTGACAGGAACACACAGAGCGG - Intronic
1198638963 X:138734789-138734811 CCTTCCAGGAAGGCACAGGCTGG - Intronic
1198813422 X:140560340-140560362 GCTGCCAGGAATACACATTGAGG - Intergenic
1201554822 Y:15256906-15256928 CCCCCCAGGATTACAAAGGGGGG + Intergenic