ID: 1133002813

View in Genome Browser
Species Human (GRCh38)
Location 16:2859696-2859718
Sequence GGCTCCCGAAGCCTCCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133002813_1133002820 4 Left 1133002813 16:2859696-2859718 CCCTCATGGAGGCTTCGGGAGCC No data
Right 1133002820 16:2859723-2859745 GGAGGTGCCTCACCCTGCCTGGG No data
1133002813_1133002821 5 Left 1133002813 16:2859696-2859718 CCCTCATGGAGGCTTCGGGAGCC No data
Right 1133002821 16:2859724-2859746 GAGGTGCCTCACCCTGCCTGGGG No data
1133002813_1133002819 3 Left 1133002813 16:2859696-2859718 CCCTCATGGAGGCTTCGGGAGCC No data
Right 1133002819 16:2859722-2859744 AGGAGGTGCCTCACCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133002813 Original CRISPR GGCTCCCGAAGCCTCCATGA GGG (reversed) Intergenic
No off target data available for this crispr