ID: 1133003709

View in Genome Browser
Species Human (GRCh38)
Location 16:2865469-2865491
Sequence GTCTCATGCCTGTAAAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133003706_1133003709 9 Left 1133003706 16:2865437-2865459 CCTCCAGCATCTCCAGCAAGACT No data
Right 1133003709 16:2865469-2865491 GTCTCATGCCTGTAAAGAGCTGG No data
1133003705_1133003709 26 Left 1133003705 16:2865420-2865442 CCTGTTTTCACACAGGGCCTCCA No data
Right 1133003709 16:2865469-2865491 GTCTCATGCCTGTAAAGAGCTGG No data
1133003707_1133003709 6 Left 1133003707 16:2865440-2865462 CCAGCATCTCCAGCAAGACTGTT No data
Right 1133003709 16:2865469-2865491 GTCTCATGCCTGTAAAGAGCTGG No data
1133003708_1133003709 -3 Left 1133003708 16:2865449-2865471 CCAGCAAGACTGTTCTGATTGTC No data
Right 1133003709 16:2865469-2865491 GTCTCATGCCTGTAAAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133003709 Original CRISPR GTCTCATGCCTGTAAAGAGC TGG Intergenic
No off target data available for this crispr