ID: 1133004319

View in Genome Browser
Species Human (GRCh38)
Location 16:2869852-2869874
Sequence GTCAGTGTGGAACAAAGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133004319_1133004327 16 Left 1133004319 16:2869852-2869874 CCAAGACTTTGTTCCACACTGAC No data
Right 1133004327 16:2869891-2869913 GTAGAGAGAGATGGGGCTGCAGG No data
1133004319_1133004329 18 Left 1133004319 16:2869852-2869874 CCAAGACTTTGTTCCACACTGAC No data
Right 1133004329 16:2869893-2869915 AGAGAGAGATGGGGCTGCAGGGG No data
1133004319_1133004323 7 Left 1133004319 16:2869852-2869874 CCAAGACTTTGTTCCACACTGAC No data
Right 1133004323 16:2869882-2869904 TAGGCCTGTGTAGAGAGAGATGG No data
1133004319_1133004328 17 Left 1133004319 16:2869852-2869874 CCAAGACTTTGTTCCACACTGAC No data
Right 1133004328 16:2869892-2869914 TAGAGAGAGATGGGGCTGCAGGG No data
1133004319_1133004324 8 Left 1133004319 16:2869852-2869874 CCAAGACTTTGTTCCACACTGAC No data
Right 1133004324 16:2869883-2869905 AGGCCTGTGTAGAGAGAGATGGG No data
1133004319_1133004325 9 Left 1133004319 16:2869852-2869874 CCAAGACTTTGTTCCACACTGAC No data
Right 1133004325 16:2869884-2869906 GGCCTGTGTAGAGAGAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133004319 Original CRISPR GTCAGTGTGGAACAAAGTCT TGG (reversed) Intergenic
No off target data available for this crispr