ID: 1133004979 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:2875031-2875053 |
| Sequence | GAGGGCGCGCGCGGACTCAG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1133004969_1133004979 | 21 | Left | 1133004969 | 16:2874987-2875009 | CCGGAACCTGGGGACATTCTGGC | No data | ||
| Right | 1133004979 | 16:2875031-2875053 | GAGGGCGCGCGCGGACTCAGCGG | No data | ||||
| 1133004970_1133004979 | 15 | Left | 1133004970 | 16:2874993-2875015 | CCTGGGGACATTCTGGCCGATGC | No data | ||
| Right | 1133004979 | 16:2875031-2875053 | GAGGGCGCGCGCGGACTCAGCGG | No data | ||||
| 1133004974_1133004979 | -1 | Left | 1133004974 | 16:2875009-2875031 | CCGATGCTCTTGGCGGCCAGGAG | No data | ||
| Right | 1133004979 | 16:2875031-2875053 | GAGGGCGCGCGCGGACTCAGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1133004979 | Original CRISPR | GAGGGCGCGCGCGGACTCAG CGG | Intergenic | ||