ID: 1133004979

View in Genome Browser
Species Human (GRCh38)
Location 16:2875031-2875053
Sequence GAGGGCGCGCGCGGACTCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133004969_1133004979 21 Left 1133004969 16:2874987-2875009 CCGGAACCTGGGGACATTCTGGC No data
Right 1133004979 16:2875031-2875053 GAGGGCGCGCGCGGACTCAGCGG No data
1133004970_1133004979 15 Left 1133004970 16:2874993-2875015 CCTGGGGACATTCTGGCCGATGC No data
Right 1133004979 16:2875031-2875053 GAGGGCGCGCGCGGACTCAGCGG No data
1133004974_1133004979 -1 Left 1133004974 16:2875009-2875031 CCGATGCTCTTGGCGGCCAGGAG No data
Right 1133004979 16:2875031-2875053 GAGGGCGCGCGCGGACTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133004979 Original CRISPR GAGGGCGCGCGCGGACTCAG CGG Intergenic