ID: 1133006166

View in Genome Browser
Species Human (GRCh38)
Location 16:2883015-2883037
Sequence TATCCCAGCACCAGTGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133006166_1133006172 2 Left 1133006166 16:2883015-2883037 CCCAACCCACTGGTGCTGGGATA 0: 1
1: 0
2: 1
3: 16
4: 123
Right 1133006172 16:2883040-2883062 CTCGCCCGCAACCCGGATCCAGG 0: 1
1: 0
2: 0
3: 1
4: 60
1133006166_1133006175 9 Left 1133006166 16:2883015-2883037 CCCAACCCACTGGTGCTGGGATA 0: 1
1: 0
2: 1
3: 16
4: 123
Right 1133006175 16:2883047-2883069 GCAACCCGGATCCAGGCCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 69
1133006166_1133006170 -5 Left 1133006166 16:2883015-2883037 CCCAACCCACTGGTGCTGGGATA 0: 1
1: 0
2: 1
3: 16
4: 123
Right 1133006170 16:2883033-2883055 GGATAACCTCGCCCGCAACCCGG 0: 1
1: 0
2: 0
3: 2
4: 21
1133006166_1133006178 19 Left 1133006166 16:2883015-2883037 CCCAACCCACTGGTGCTGGGATA 0: 1
1: 0
2: 1
3: 16
4: 123
Right 1133006178 16:2883057-2883079 TCCAGGCCGCAGGTCCCCCGAGG 0: 1
1: 0
2: 1
3: 16
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133006166 Original CRISPR TATCCCAGCACCAGTGGGTT GGG (reversed) Intergenic
905029519 1:34872297-34872319 GATCCAAGCAAGAGTGGGTTTGG + Intronic
906151672 1:43591340-43591362 TATCCCCGCACCAGGCCGTTGGG - Exonic
909601406 1:77465133-77465155 TATCCCAGGAAGAGAGGGTTTGG - Intronic
910100536 1:83570767-83570789 GATCAAGGCACCAGTGGGTTTGG + Intergenic
915322185 1:155062166-155062188 TTCCCCAGCACCAGTGCGTTGGG + Intronic
918264433 1:182828093-182828115 TATCCCCAGACCAGTGGGCTGGG + Intronic
918843000 1:189568581-189568603 TGTCCCAACACCATTAGGTTTGG - Intergenic
922331129 1:224576975-224576997 TATCCCAGCACCATTTGTTAGGG - Intronic
924429620 1:243985798-243985820 TACCGCAGCAACAGTGGGTAGGG + Intergenic
1064913251 10:20426995-20427017 GGTCCCAGCACCAGAGGGTTAGG - Intergenic
1074944237 10:118265749-118265771 TATCCCTGCACAATGGGGTTGGG + Intergenic
1077407547 11:2389372-2389394 TCTCCCACCACCAGAGGGCTGGG + Intronic
1079677509 11:23248726-23248748 TATACCAGTACCATTGGTTTGGG + Intergenic
1080691276 11:34560527-34560549 TATCCCAGCACCAGCATGTTTGG + Intergenic
1083895833 11:65619319-65619341 CCTCCCACCACCAGTGGGGTGGG + Intronic
1085051005 11:73380236-73380258 GATCCCAGCACCTGTGTGCTGGG + Intronic
1090217143 11:124979029-124979051 TATCCCAGTACCACTGAATTGGG + Intronic
1096577019 12:52559103-52559125 TATCCCAGCTCCTCTGGGGTGGG - Intergenic
1097715243 12:62959387-62959409 TTTCCAAGGACCAGTGGCTTAGG - Intergenic
1097908460 12:64944566-64944588 TCTCACAGCTTCAGTGGGTTAGG + Intergenic
1098945046 12:76580531-76580553 TTTCCCAGCACCATTTGTTTAGG - Intergenic
1099123075 12:78717109-78717131 CATCCCAGCATCAGTCTGTTTGG - Intergenic
1102848696 12:116217100-116217122 CATCCCAGCACAATTGGGTTAGG - Intronic
1104820483 12:131674570-131674592 TAAGCCAGCTCCAGTGGGCTGGG - Intergenic
1113851374 13:113420578-113420600 GGTCCCAGCACCCGTGGGTGTGG - Intergenic
1114429907 14:22652005-22652027 TAGGTCAGGACCAGTGGGTTAGG + Intergenic
1118694286 14:68369238-68369260 TAGCCTAGTGCCAGTGGGTTTGG + Intronic
1118762106 14:68886252-68886274 CATACCAGCAGCAGAGGGTTGGG - Intronic
1118797813 14:69159500-69159522 CATCCCAGCACCACTTGTTTAGG + Intergenic
1118949886 14:70426482-70426504 TCCTCCAGCACCACTGGGTTAGG - Intergenic
1121509927 14:94504979-94505001 CATCCCAGCATCAGTGGGTTTGG - Intronic
1122338145 14:101007242-101007264 GAGCCCAGCAGCAATGGGTTGGG - Intergenic
1124022432 15:25937016-25937038 GATCCAAGCACCAGCAGGTTCGG - Intergenic
1125786761 15:42325505-42325527 TATGCCTGCACCACTGGGCTTGG + Intronic
1126400934 15:48269682-48269704 TATCCAATCACCAGAGTGTTTGG - Exonic
1129361286 15:75026196-75026218 TATCCTAGCACCAGTTGGCTAGG + Intronic
1131525108 15:93146434-93146456 GTTCCCAGTACCACTGGGTTTGG + Intergenic
1131609539 15:93946773-93946795 CATCCCAGAGCCAATGGGTTGGG - Intergenic
1133006166 16:2883015-2883037 TATCCCAGCACCAGTGGGTTGGG - Intergenic
1138432908 16:56980974-56980996 TTCCCCAGCACCTGTGGCTTTGG - Intronic
1138532787 16:57643864-57643886 TATCCCAGGACCCATGGGTGCGG + Intronic
1140032992 16:71353403-71353425 TATCCCTGAACCAGTTGCTTTGG + Intergenic
1141701320 16:85643509-85643531 TTTCTAAGCACCAGTGGGTGAGG - Intronic
1141751497 16:85961467-85961489 CCTCCCAGCACCCTTGGGTTGGG + Intergenic
1143248525 17:5505136-5505158 TTTCCCATCAACTGTGGGTTTGG - Intronic
1144662691 17:17081558-17081580 TACCTCAGCCCCACTGGGTTGGG + Intronic
1145903618 17:28504620-28504642 TTTCCCAGCACCACTGGCCTTGG + Intronic
1146931711 17:36782576-36782598 GATCCCAGAATCGGTGGGTTAGG - Intergenic
1148460699 17:47837655-47837677 TATCCCAGGACCAGTGGGGGTGG - Exonic
1148575063 17:48704682-48704704 TATCCAAGCACCAGTCTGTCTGG + Intergenic
1152855345 17:82662497-82662519 AACCCCAGCCCCAGTGGGTGTGG + Intronic
1152994756 18:396174-396196 GATCCCAACACCGGTGTGTTTGG + Intronic
1153520134 18:5943895-5943917 TATCCCAGCAGCAGAGGGACTGG + Intergenic
1156432611 18:37092144-37092166 TGTGCCAGCAGCAGTGGGCTGGG - Intronic
1156948736 18:42867537-42867559 AATCCCAGCACCACTGAGGTGGG + Intronic
1159007621 18:63026521-63026543 TATACCATCACCTGGGGGTTAGG - Intergenic
1160605473 18:80046557-80046579 GAGCCCAGCTCCAGGGGGTTGGG - Intronic
1161818471 19:6515140-6515162 TTTCTCAGCACCAGTGGCCTGGG - Intergenic
1164864005 19:31588810-31588832 TATCTCAGAACCAGTGGCTTTGG + Intergenic
1165402055 19:35607576-35607598 TCCTCTAGCACCAGTGGGTTAGG + Intergenic
1167773965 19:51542817-51542839 GATCCCAGGAGAAGTGGGTTGGG + Intergenic
930066587 2:47332468-47332490 TCTCCCAGCAGCCATGGGTTGGG - Intergenic
934570613 2:95369872-95369894 AATCCCAGCACCAGAGGCTGAGG - Intronic
936703636 2:115043058-115043080 TATTCCAGCACCACTGGGCCAGG - Intronic
936786099 2:116095368-116095390 TTTCCTTGCACCAGGGGGTTGGG + Intergenic
939526940 2:143307016-143307038 TCTCCCAACACCAGTGAGTTTGG - Intronic
945480587 2:210340235-210340257 GTTCCCATCAACAGTGGGTTGGG - Intergenic
1169831561 20:9831038-9831060 TATCCCATGCCCAGTGGGCTGGG + Intronic
1170486784 20:16825717-16825739 TATCCCAGCACCATTTAGTAAGG - Intergenic
1170556032 20:17515321-17515343 TATCTCATCATCAGTGAGTTGGG + Intronic
1171260426 20:23727123-23727145 TCTCCCAGCCTCTGTGGGTTTGG + Intergenic
1175459523 20:59141919-59141941 TCTCCCAGCACCCCTGTGTTGGG + Intergenic
1179543495 21:42099659-42099681 TGTCCCAGCACCAATGTGGTGGG - Intronic
1181627956 22:24134075-24134097 TGGCCCAGCACCACTGGTTTAGG - Intronic
1181920956 22:26320206-26320228 TATCTCAGCATCACTGGATTGGG - Intronic
1183402049 22:37610237-37610259 AATCCCAGCCCCAGTGTGTCAGG - Intronic
1184542599 22:45138685-45138707 TATCCCAGCAACAGTGACTTTGG - Intergenic
958452523 3:94291865-94291887 TATCCCTGAACCAGTGGTTGTGG - Intergenic
958495004 3:94833724-94833746 TATCCCAGCACCATTTGAATAGG - Intergenic
958962371 3:100522526-100522548 TAGGCCAGCACCAGAGAGTTAGG - Intronic
961213860 3:125144780-125144802 TATCCAAGCAACAGTGGGGCAGG - Intronic
961906320 3:130266470-130266492 CATCCCAGGACCAGTGGTTTAGG - Intergenic
962428701 3:135298997-135299019 AAACCCAGCATCAGTGGATTAGG + Intergenic
962464206 3:135641720-135641742 TATCCCAGAACCAGCTGATTAGG + Intergenic
962920503 3:139946353-139946375 TACCCCAGCAACTCTGGGTTTGG + Intronic
964662823 3:159139663-159139685 GATCCCAGGAGCAGTGGGCTGGG + Intronic
970402066 4:15726783-15726805 CATCCTAGCACCAGTGCCTTGGG + Intronic
971358585 4:25916045-25916067 TATCCCAGCAACAGTCTTTTAGG + Intronic
971385170 4:26135490-26135512 AAACCGAGCTCCAGTGGGTTGGG + Intergenic
973885364 4:55315522-55315544 TATCCCAGCACCCCTGGGTGTGG - Intergenic
978451555 4:108839842-108839864 TATGCCATCACCATTGGATTAGG - Intronic
990788183 5:59447085-59447107 TCTCACAGCACCAGAGGATTGGG - Intronic
994514403 5:100752497-100752519 TATGCCAGTGCCAGTGTGTTGGG + Intergenic
994807385 5:104467514-104467536 TATCCCAGCACCATTTGCTGAGG + Intergenic
996269927 5:121591670-121591692 TATCCCAGCACCACTGAATAGGG - Intergenic
1003600713 6:7514581-7514603 TAGCCCAGTGGCAGTGGGTTGGG + Intergenic
1004804776 6:19190929-19190951 AATCCTAGCAACAGTTGGTTGGG + Intergenic
1005303079 6:24489998-24490020 TTTCCCAGCACTTGTGGCTTGGG - Intronic
1005305440 6:24509345-24509367 TATCCCAGCACCATTTGTTGAGG + Intronic
1010879887 6:81154091-81154113 TATCACAGCCCCAGAGGTTTAGG - Intergenic
1014169350 6:118261834-118261856 CATCCCAGCCCCAGAGGGGTGGG - Intronic
1015482289 6:133725836-133725858 TATCTCAGCACCATTTTGTTTGG - Intergenic
1016690888 6:146936477-146936499 TATCCCTGCCCCAGTGGGAAAGG - Intergenic
1017156074 6:151323859-151323881 TTTCTCAGCACCAGTGGTTGGGG - Intronic
1017718829 6:157230930-157230952 TATCCCAACACCAGTGGGGATGG + Intergenic
1021129627 7:16896020-16896042 TATACCAGTACCAGTGTTTTGGG + Intergenic
1021185466 7:17559289-17559311 TATCCCAGCAGCAGAGGCTTTGG + Intergenic
1021621827 7:22556577-22556599 TATCCCAGACTCAGTGGCTTAGG + Intronic
1023967180 7:44969123-44969145 TATACCAGCATCTGTGGGGTGGG - Intronic
1025262201 7:57426719-57426741 TACCCCAGCACCAGCGGGAGTGG - Intergenic
1025739548 7:64183947-64183969 TATCCTAGCACCAGCGGGAGAGG - Intronic
1026205149 7:68250670-68250692 TAGCCCAGCAGCACTGGCTTCGG + Intergenic
1026538342 7:71259077-71259099 TCTCCCCGCTCCAGTGGGTACGG - Intronic
1031978093 7:128106514-128106536 TTCCCCAGCACCAGTGTCTTTGG + Intergenic
1032483243 7:132263238-132263260 TGGCCCACCACCAGTGGGGTGGG + Intronic
1035171670 7:157020848-157020870 TATCCCAGAACCACTGGGCTGGG - Intergenic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1041735918 8:61110161-61110183 CCTCCCACCACCAGTGGGGTCGG + Intronic
1043946721 8:86261865-86261887 TGTACCATCTCCAGTGGGTTTGG - Intronic
1044442312 8:92237006-92237028 TCCTCCAGCACCACTGGGTTAGG + Intergenic
1044631335 8:94281259-94281281 TAGCCCAGAACTAGTGGGTGTGG - Intergenic
1045437425 8:102178178-102178200 TCTCACAGCATCTGTGGGTTGGG + Intergenic
1046389753 8:113554825-113554847 TACTCTAGCACCACTGGGTTAGG - Intergenic
1049531759 8:143158793-143158815 GATCCCAGCAGCAGTAAGTTGGG - Exonic
1049640390 8:143712566-143712588 TAAGCCAGCCCCAGTGGGTGGGG - Intronic
1051910973 9:22154256-22154278 TACTCCAGCACCAGTGGGAGTGG - Intergenic
1054830488 9:69619638-69619660 AATCCAAGCACAAGTGAGTTGGG - Intronic
1054941345 9:70746068-70746090 TCTCCCAGCAACAGGGTGTTGGG + Intronic
1057216434 9:93231316-93231338 TATCCCAGCCCAAGTGGTCTGGG - Intronic
1058463232 9:105202915-105202937 TATACCATCAACAGTGGTTTAGG + Intergenic
1061390140 9:130313119-130313141 TGGCCCAGCACCTGTGGGTCTGG + Intronic
1062372904 9:136249313-136249335 GCTCCCAGCACCAGTGTGGTTGG + Intergenic
1189966775 X:46381797-46381819 TATGAGAGCACCAGTTGGTTAGG - Intergenic
1195672906 X:107484246-107484268 TTCCCCAGCAGCACTGGGTTGGG - Intergenic
1196141113 X:112264722-112264744 TATCCCAGCTCCAGTGTGGGAGG - Intergenic
1196682360 X:118482193-118482215 TATCCCAGCACCATTTGGTGGGG + Intergenic
1198984406 X:142433256-142433278 TATCCCAGCACCCAAGGGTGAGG + Intergenic
1199178062 X:144815964-144815986 TATGCCAGCACCATAAGGTTTGG - Intergenic
1199298110 X:146182200-146182222 GATCATAGCACCAGTGGATTCGG + Intergenic
1199327482 X:146515914-146515936 TATGCCAGTACCATTGTGTTTGG + Intergenic
1199635224 X:149807021-149807043 CATCCCATCACCATTGGGTGGGG - Intergenic