ID: 1133006253 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:2883329-2883351 |
| Sequence | GGCGCTGTCGCCGGAGAGGG AGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 181 | |||
| Summary | {0: 1, 1: 1, 2: 1, 3: 13, 4: 165} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1133006245_1133006253 | 7 | Left | 1133006245 | 16:2883299-2883321 | CCTTGGCGCGGAGGCTGAGGGAC | 0: 1 1: 0 2: 0 3: 13 4: 150 |
||
| Right | 1133006253 | 16:2883329-2883351 | GGCGCTGTCGCCGGAGAGGGAGG | 0: 1 1: 1 2: 1 3: 13 4: 165 |
||||
| 1133006244_1133006253 | 8 | Left | 1133006244 | 16:2883298-2883320 | CCCTTGGCGCGGAGGCTGAGGGA | 0: 1 1: 0 2: 1 3: 7 4: 97 |
||
| Right | 1133006253 | 16:2883329-2883351 | GGCGCTGTCGCCGGAGAGGGAGG | 0: 1 1: 1 2: 1 3: 13 4: 165 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1133006253 | Original CRISPR | GGCGCTGTCGCCGGAGAGGG AGG | Exonic | ||