ID: 1133006253

View in Genome Browser
Species Human (GRCh38)
Location 16:2883329-2883351
Sequence GGCGCTGTCGCCGGAGAGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 1, 2: 1, 3: 13, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133006245_1133006253 7 Left 1133006245 16:2883299-2883321 CCTTGGCGCGGAGGCTGAGGGAC 0: 1
1: 0
2: 0
3: 13
4: 150
Right 1133006253 16:2883329-2883351 GGCGCTGTCGCCGGAGAGGGAGG 0: 1
1: 1
2: 1
3: 13
4: 165
1133006244_1133006253 8 Left 1133006244 16:2883298-2883320 CCCTTGGCGCGGAGGCTGAGGGA 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1133006253 16:2883329-2883351 GGCGCTGTCGCCGGAGAGGGAGG 0: 1
1: 1
2: 1
3: 13
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133006253 Original CRISPR GGCGCTGTCGCCGGAGAGGG AGG Exonic