ID: 1133008256

View in Genome Browser
Species Human (GRCh38)
Location 16:2896544-2896566
Sequence GAACTTTCTGGGCTTCCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 275}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133008256_1133008269 26 Left 1133008256 16:2896544-2896566 CCCCCAGGAAGCCCAGAAAGTTC 0: 1
1: 0
2: 2
3: 25
4: 275
Right 1133008269 16:2896593-2896615 CAAAGACAGCACCAAGGTGGCGG 0: 1
1: 1
2: 10
3: 74
4: 417
1133008256_1133008270 27 Left 1133008256 16:2896544-2896566 CCCCCAGGAAGCCCAGAAAGTTC 0: 1
1: 0
2: 2
3: 25
4: 275
Right 1133008270 16:2896594-2896616 AAAGACAGCACCAAGGTGGCGGG 0: 1
1: 1
2: 3
3: 37
4: 365
1133008256_1133008267 23 Left 1133008256 16:2896544-2896566 CCCCCAGGAAGCCCAGAAAGTTC 0: 1
1: 0
2: 2
3: 25
4: 275
Right 1133008267 16:2896590-2896612 CTCCAAAGACAGCACCAAGGTGG 0: 1
1: 0
2: 3
3: 24
4: 276
1133008256_1133008271 28 Left 1133008256 16:2896544-2896566 CCCCCAGGAAGCCCAGAAAGTTC 0: 1
1: 0
2: 2
3: 25
4: 275
Right 1133008271 16:2896595-2896617 AAGACAGCACCAAGGTGGCGGGG 0: 1
1: 0
2: 1
3: 13
4: 166
1133008256_1133008265 20 Left 1133008256 16:2896544-2896566 CCCCCAGGAAGCCCAGAAAGTTC 0: 1
1: 0
2: 2
3: 25
4: 275
Right 1133008265 16:2896587-2896609 AGCCTCCAAAGACAGCACCAAGG 0: 1
1: 0
2: 2
3: 14
4: 261
1133008256_1133008272 29 Left 1133008256 16:2896544-2896566 CCCCCAGGAAGCCCAGAAAGTTC 0: 1
1: 0
2: 2
3: 25
4: 275
Right 1133008272 16:2896596-2896618 AGACAGCACCAAGGTGGCGGGGG 0: 1
1: 0
2: 1
3: 19
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133008256 Original CRISPR GAACTTTCTGGGCTTCCTGG GGG (reversed) Exonic
900526661 1:3132622-3132644 GAACATTCTGGACCTCATGGGGG - Intronic
901050816 1:6425102-6425124 GCACTGTCTGCGCTTCCTGGTGG + Exonic
901092893 1:6654177-6654199 ATGCTTTGTGGGCTTCCTGGTGG - Intronic
902577327 1:17386561-17386583 GAAGTTGCAGGGGTTCCTGGGGG + Intronic
903539272 1:24087592-24087614 GAAATCTCTTGGCTTCCTGTAGG + Intronic
903918311 1:26780477-26780499 CAACCTCCTGGGCTTCCTAGAGG + Exonic
905617354 1:39410117-39410139 GAACTTCCAGGCCTTTCTGGAGG + Intronic
906843107 1:49160974-49160996 TAGCTTTCTGGGCTCCCTCGGGG + Intronic
908630726 1:66103748-66103770 GAACTTCTTGGGCTTCCATGTGG + Intronic
910284684 1:85540616-85540638 GAAGTTGCTGGGCTTTATGGTGG - Intronic
911692056 1:100845564-100845586 TAGCTTGCTGGGCTCCCTGGGGG + Intergenic
912793394 1:112674905-112674927 GAACTTACTGGGCATCGCGGCGG - Exonic
913050768 1:115114974-115114996 GAACTTTCTGAACTTTCTCGGGG + Intergenic
913283833 1:117209837-117209859 GAACTTTCTAGGCTGCCTCTGGG + Intronic
916029515 1:160863776-160863798 GAGCTGCCTGGCCTTCCTGGAGG - Intergenic
916520334 1:165557874-165557896 GAACCTTCTGGGCTGACTGGAGG - Intronic
916720057 1:167477986-167478008 GAACTTTCATGACATCCTGGTGG - Intronic
917163154 1:172080548-172080570 TAGCTTGCTGGGCTTCATGGGGG + Intronic
917455083 1:175179253-175179275 CAACTTTCAGGGCCTCCTTGAGG - Intronic
917584989 1:176417093-176417115 GAGCTTGCTGGGCTTTCTGGTGG + Intergenic
918353685 1:183684512-183684534 TAGCTTTCTGGGCTTCATGGGGG + Intronic
918356491 1:183710022-183710044 CAACTTCCTGGCATTCCTGGTGG + Intronic
921401393 1:214727571-214727593 GAGCTTGCTGGGCTCCGTGGGGG + Intergenic
922534720 1:226371301-226371323 GACCCTTCTGAGCTCCCTGGGGG + Intronic
1067546185 10:47194262-47194284 GAAGTATCTGGGCATCATGGTGG - Intergenic
1068123604 10:52810911-52810933 GAACTTGGTGGGGTTCTTGGAGG - Intergenic
1068858103 10:61818047-61818069 GCACTATCTTGGCTTCCTGAAGG - Intergenic
1070682369 10:78457366-78457388 GAAATTTCTGTGCCTCATGGTGG + Intergenic
1070707801 10:78654075-78654097 GAAGACTCTGGGCTTCCTTGAGG + Intergenic
1071494083 10:86155831-86155853 GGATTTTCAGAGCTTCCTGGAGG - Intronic
1073933473 10:108602143-108602165 GAACTTTCTAGGATTAATGGAGG + Intergenic
1076875058 10:133211705-133211727 GCACCTGCTGGGCCTCCTGGAGG + Exonic
1078668264 11:13343576-13343598 CAACTCACTGGGCATCCTGGGGG - Intronic
1079017333 11:16880247-16880269 GATCTGCCTGGGCTTCCTGCAGG - Intronic
1079030383 11:16982110-16982132 GTACTTTCCCAGCTTCCTGGGGG - Intronic
1079698751 11:23518041-23518063 GAGCTACCTGGGCTACCTGGTGG + Intergenic
1080394598 11:31878219-31878241 GAACTTTCTGGTCATCTTGTTGG + Intronic
1082903612 11:58283210-58283232 GAGCTTGCTGGGCTTTGTGGGGG + Intergenic
1083801007 11:65046225-65046247 GATCTTGCTGGGCTGCCTGCAGG + Exonic
1086462192 11:87017168-87017190 TAACTTTCTGGGGGTTCTGGAGG - Intergenic
1087394551 11:97580795-97580817 GAACTTTGTGGGATTCTTGGAGG - Intergenic
1087508668 11:99061456-99061478 CACCTCTCTGGCCTTCCTGGTGG - Intronic
1088626998 11:111736612-111736634 GAACATTCTTGCCTTCCTGAGGG - Intronic
1088648545 11:111937523-111937545 GAACTTACTGGACGTCCTGCAGG + Intronic
1089127246 11:116185227-116185249 GTACTTTCTTTGCCTCCTGGGGG - Intergenic
1089615705 11:119693576-119693598 CCACTTCCTGGGCTTCATGGTGG - Intronic
1089659317 11:119975731-119975753 TCACTTACTGGGCGTCCTGGCGG - Intergenic
1091484282 12:868853-868875 GAATATTCTGGGCTTCCTATTGG - Intronic
1091892273 12:4068650-4068672 GTGTTTTCTGAGCTTCCTGGAGG + Intergenic
1092163587 12:6329374-6329396 GGACCTGCTGGGCTGCCTGGAGG - Exonic
1092708337 12:11308552-11308574 GGTCTTTCTGGCTTTCCTGGAGG + Exonic
1092708357 12:11308615-11308637 GGTCTTTCTGGCTTTCCTGGAGG + Exonic
1094232886 12:28128230-28128252 GAACTTTTTGTACTTCCTGATGG - Intergenic
1095356413 12:41280431-41280453 GAGCTTGCTGGGCTCCATGGGGG - Intronic
1096884174 12:54699982-54700004 GAGTTTTCTGGGAATCCTGGGGG + Intergenic
1097053081 12:56235251-56235273 GCCCTTGCTGGGCTTCCTGGGGG + Exonic
1097273305 12:57793004-57793026 GAGCTTTCTGGACTTCCAGCTGG + Exonic
1097825582 12:64172201-64172223 TAATTTTCTGGTCTTCCTGCAGG - Intergenic
1098209510 12:68148822-68148844 GAACTTGGTGGGATTCCTGTAGG + Intergenic
1099492028 12:83299965-83299987 TAGCTTGCTGGGCTCCCTGGGGG - Intergenic
1099798024 12:87422580-87422602 TAGCTTTCTGGGCTCCATGGGGG + Intergenic
1100708067 12:97223232-97223254 GAAATTTCAGGACTTGCTGGGGG + Intergenic
1102708104 12:114900098-114900120 CAACTTTCTCTGCTTCCTGGGGG + Intergenic
1103488937 12:121301934-121301956 GAATTTTCTGGTGTTCTTGGAGG - Intergenic
1106306490 13:28515670-28515692 GAACTTGGTGGAGTTCCTGGAGG + Intergenic
1106426598 13:29636582-29636604 TAGCTTCCTGGGCTTCCTGGGGG + Intergenic
1106594507 13:31125010-31125032 CCAGGTTCTGGGCTTCCTGGAGG - Intergenic
1106953156 13:34906812-34906834 GAAATTTCTAGGTTTCCTGTAGG - Intergenic
1108665468 13:52625400-52625422 TATCTTTCAGGGCTTCGTGGTGG - Intergenic
1108879681 13:55095304-55095326 GAACATGGTGGGGTTCCTGGAGG - Intergenic
1109089305 13:58019223-58019245 GACTTTTCTCTGCTTCCTGGGGG - Intergenic
1109187888 13:59291915-59291937 TCACTTGCTGGGCTTCGTGGGGG - Intergenic
1110710400 13:78644573-78644595 GAACTCTCTGGGCTTTTTTGGGG + Intronic
1113086758 13:106576734-106576756 GAACCTGGTGGGGTTCCTGGAGG + Intergenic
1114530753 14:23394277-23394299 GAACATTCGGGCCTTCATGGGGG - Exonic
1114536266 14:23424978-23425000 GAACATTCGGGCCTTCATGGGGG - Exonic
1115842756 14:37490375-37490397 TAACTTGCTGGGCTCCGTGGGGG + Intronic
1116090350 14:40296286-40296308 AAACTTTCTGGGCTTCATGCAGG + Intergenic
1117859359 14:60073701-60073723 TAACTTGCTGGGCTTCATCGGGG - Intergenic
1119078659 14:71671287-71671309 GATCTTTCAGGTATTCCTGGCGG - Exonic
1119500763 14:75125824-75125846 GAACTTGCTGGGGTTGCTGAAGG - Intronic
1119630785 14:76230098-76230120 CAGCTCTCTGGGTTTCCTGGTGG + Intronic
1121837898 14:97108337-97108359 AATCTTTTTAGGCTTCCTGGAGG - Intergenic
1122367341 14:101201918-101201940 GCACGTGCTGGGCTTTCTGGAGG + Intergenic
1124168143 15:27347662-27347684 GAACCTTATAGGATTCCTGGAGG + Intronic
1124814049 15:32970457-32970479 GTACTTCCTGGGCTACCTGCTGG - Intronic
1125227158 15:37408372-37408394 TAGCTTCCTGGGCTTCATGGGGG - Intergenic
1126674029 15:51143420-51143442 GAATTATCATGGCTTCCTGGTGG + Intergenic
1129661974 15:77557987-77558009 GAACATTTAGGGGTTCCTGGTGG - Intergenic
1130137694 15:81195681-81195703 AATGTTTCAGGGCTTCCTGGGGG - Intronic
1131815755 15:96219480-96219502 AAATTTGCTGGGCTTCATGGTGG + Intergenic
1133008256 16:2896544-2896566 GAACTTTCTGGGCTTCCTGGGGG - Exonic
1133013822 16:2929780-2929802 GAACTCCCTGGGCTTCCTGGGGG - Exonic
1134240867 16:12505388-12505410 GAATTTTCTTGGCATCCTTGTGG + Intronic
1134818389 16:17225489-17225511 AAACTTTCTGGGTTTGCTGATGG - Intronic
1137817386 16:51411423-51411445 GAACTGGCAAGGCTTCCTGGAGG + Intergenic
1138312468 16:56039761-56039783 GAACTTTCTGTTCTTCATGATGG - Intergenic
1138483047 16:57316867-57316889 GGACTTTCTGGGCTCCCAGCTGG - Intergenic
1139104653 16:63813765-63813787 GAACCTAGTGGGGTTCCTGGAGG - Intergenic
1139845047 16:69914925-69914947 CTTCTTTCTTGGCTTCCTGGTGG - Intronic
1141656991 16:85421769-85421791 TACCTCTCTGGGGTTCCTGGTGG - Intergenic
1142919687 17:3173165-3173187 AAGCTTCCTGAGCTTCCTGGGGG - Intergenic
1143593569 17:7900558-7900580 CAACTTGGAGGGCTTCCTGGAGG + Exonic
1144646612 17:16979143-16979165 GAACTATCTGGGCATCTGGGAGG - Intergenic
1144648266 17:16990188-16990210 GAACTTTCTGGGATGGTTGGAGG - Intergenic
1146259396 17:31411786-31411808 GAATTTGCTGAGCTGCCTGGGGG + Intronic
1146280044 17:31538807-31538829 GAACTGTCTGCCCTCCCTGGAGG - Intergenic
1146660142 17:34660085-34660107 CATCTTTCTGGGCTCGCTGGGGG - Intergenic
1147329082 17:39685939-39685961 GCACTTTGTGACCTTCCTGGAGG + Exonic
1147600467 17:41742097-41742119 GGATGCTCTGGGCTTCCTGGAGG - Intergenic
1148451133 17:47778445-47778467 TGCCTTTCTCGGCTTCCTGGGGG + Intergenic
1148805627 17:50262463-50262485 GATCTGAGTGGGCTTCCTGGAGG + Intergenic
1150390116 17:64785086-64785108 GGACTTCCTGGGCTTTCTGTAGG + Intergenic
1152113453 17:78370181-78370203 GAACGTCCTGGGCTTCTTTGTGG + Intergenic
1153119678 18:1706129-1706151 GAACCTGGTGGTCTTCCTGGAGG + Intergenic
1154123535 18:11670582-11670604 GAGCTCACTGGGCTTCCTGCTGG + Intergenic
1158125734 18:54098075-54098097 GAACTTGCTGGGTTCCCTGTGGG - Intergenic
1158528318 18:58235048-58235070 GAACATTCTGGGCTTCTCGGTGG - Intronic
1158889822 18:61862591-61862613 GAACATGCTGAGGTTCCTGGAGG + Intronic
1159017637 18:63114710-63114732 GAACATGCTGAGGTTCCTGGAGG + Intergenic
1159941452 18:74412027-74412049 GAACTTGCTGCCCTTCCAGGAGG - Intergenic
1160410384 18:78671739-78671761 GGACTTTCTGGGCTTGCAGGAGG + Intergenic
1160863230 19:1246345-1246367 GAACTTGCTGGGCTTCACAGGGG - Intergenic
1162039349 19:7960380-7960402 GAAATTCATGGGCTTCCTCGGGG - Exonic
1162565899 19:11445813-11445835 GAGCTTGCTGGGTTACCTGGTGG + Intronic
1163093562 19:15038581-15038603 CATCATTCTGGGCTTCCTTGGGG - Intergenic
1163366383 19:16878176-16878198 GAACTTCTTGAGGTTCCTGGGGG - Exonic
1163517864 19:17775705-17775727 GATCTAGCAGGGCTTCCTGGAGG + Intronic
1164879205 19:31716649-31716671 ATGCTTTCTGGGCTTCCTTGGGG + Intergenic
1166062834 19:40337401-40337423 AAATTTTCTTGGCTTCTTGGTGG + Intronic
1166450062 19:42891104-42891126 GAACTTTCTTGCCTACCTGCAGG + Intronic
1166461948 19:42995388-42995410 GAACTTTCTTGCCTACCTGCAGG + Intronic
1166479222 19:43155355-43155377 GAACTTTCTCGCCTACCTGCAGG + Intronic
1166685591 19:44794247-44794269 GGCATTTCTGGGCTTCCTGGGGG - Exonic
1166998952 19:46733713-46733735 GATCTTTCTAGGCCTCTTGGGGG - Intronic
925071626 2:973488-973510 GGATTCTCTGGGCTTCTTGGGGG + Intronic
925292438 2:2756619-2756641 GACTTTTCTGGGGTTCATGGAGG - Intergenic
926452130 2:13017965-13017987 GACTTTTCTTGGCTTCTTGGAGG - Intergenic
926634341 2:15164274-15164296 GAACCTGGTGGGCATCCTGGAGG - Intergenic
926922052 2:17948609-17948631 GAAATGTCTGGGTTTCCTTGAGG - Intronic
927038600 2:19205671-19205693 TTACTTTCAGGGCTTCCTGAGGG + Intergenic
927117146 2:19916455-19916477 GAGCTTACTGGGCTCCATGGGGG - Intronic
928576726 2:32663099-32663121 TAGCTTGCTGGGCTTCATGGGGG + Intronic
929850579 2:45585289-45585311 GTACTTTCTGAGTTTCCTGCTGG + Intronic
930690904 2:54363309-54363331 GAGCTCTTTGGTCTTCCTGGGGG + Intronic
931804497 2:65790778-65790800 ACACTTGCTGGGATTCCTGGGGG - Intergenic
932927472 2:75993888-75993910 TAACTTCCTGGGCCTCCAGGAGG + Intergenic
933400179 2:81786265-81786287 CAACTTTCTGAGCTTCCAGCTGG - Intergenic
937259103 2:120574097-120574119 CCACTTCCTGGGCTTTCTGGGGG + Intergenic
938019147 2:127891946-127891968 GAACTTCCTGCACTTGCTGGAGG + Intergenic
939946910 2:148421648-148421670 TAGCTTGCTGGGCTCCCTGGGGG - Intronic
941119576 2:161513404-161513426 TAGCTTGCTGGGCTCCCTGGGGG - Intronic
942771743 2:179529384-179529406 GAACTTTCTTAGCATCCTGATGG - Intronic
944641912 2:201735816-201735838 AAAGCTTCTGGGCTTCCTGAAGG - Intronic
945127746 2:206531529-206531551 GAACTTTCTTGTCTTCAGGGAGG + Intronic
945869236 2:215208358-215208380 GAACTTTCATGTCTACCTGGAGG + Intergenic
946313069 2:218893503-218893525 GAACTGTCTGGGCTTCGGGGAGG - Exonic
949001749 2:241618786-241618808 GAACCTGATGGGGTTCCTGGAGG - Intronic
1168949942 20:1790649-1790671 GAACTTGGTGAGCTTTCTGGAGG - Intergenic
1169168476 20:3443650-3443672 GAACAGTCTGTGCTACCTGGAGG + Intergenic
1170660132 20:18330367-18330389 GATCTGTCTGGGCTCCCTGAAGG + Intergenic
1171002636 20:21430130-21430152 GAACCTGGTGGGGTTCCTGGAGG + Intergenic
1172091718 20:32437500-32437522 GACCCTTCTGGTCTTGCTGGAGG + Exonic
1173573778 20:44096749-44096771 GGACTTCCTGGGCTCCCTGAGGG + Intergenic
1176144609 20:63559985-63560007 GAAGTTTCTGGGCTTCGTTGTGG - Exonic
1179161530 21:38903457-38903479 GCACTTTCTAGGCTTCATGCAGG - Intergenic
1179190299 21:39117360-39117382 GCACATTTAGGGCTTCCTGGGGG - Intergenic
1179986797 21:44926753-44926775 GGAATTTCTGGGCTGACTGGAGG - Intronic
1180056033 21:45359672-45359694 CAGCTTTCTGGGTCTCCTGGAGG - Intergenic
1180229745 21:46419981-46420003 GAACTTCCTCGTCTCCCTGGTGG + Intronic
1181160350 22:20956551-20956573 AAGCATTCTTGGCTTCCTGGAGG + Intergenic
1181616934 22:24061316-24061338 GAACATTCAGGGATGCCTGGTGG + Intronic
1183433865 22:37782169-37782191 GATCTTGGGGGGCTTCCTGGAGG - Intergenic
1184450495 22:44579684-44579706 GAGCCTCCAGGGCTTCCTGGAGG - Intergenic
1185027410 22:48423504-48423526 GAGCATGCTGGCCTTCCTGGCGG - Intergenic
1185114233 22:48922303-48922325 GAACCTGGTGGGGTTCCTGGAGG - Intergenic
1185262936 22:49880269-49880291 GAACTGCCAGGGCTCCCTGGAGG - Intronic
949175958 3:1063119-1063141 TACCTTTCTGGGCTCCATGGGGG + Intergenic
949994051 3:9602406-9602428 GAGCTGTCTGGTCTTCATGGGGG - Intergenic
950597467 3:13997203-13997225 TAGCTTGCTGGGCTCCCTGGGGG + Intronic
950623511 3:14226723-14226745 GCACTTCCTGGTGTTCCTGGGGG - Intergenic
953142554 3:40242438-40242460 GAACATTCTGGCCTTGCTGAGGG + Intronic
953658971 3:44876595-44876617 GACCTTTCTGGGATTCGTTGTGG - Intronic
954432007 3:50475843-50475865 GAGCTTTTTGGGCTTTCAGGAGG - Intronic
954524937 3:51261629-51261651 TAACTTGCTGGGCTCCGTGGGGG - Intronic
954537651 3:51373509-51373531 TAACTTGCTGGCTTTCCTGGGGG - Intronic
955139089 3:56251157-56251179 GAACTTTCTGTAGTTTCTGGTGG - Intronic
956103008 3:65788051-65788073 GACCTTTCTAGGTTTCCTTGAGG + Intronic
957647289 3:82947712-82947734 AAACTTACTGTGCTTCCTGATGG - Intergenic
958855360 3:99377532-99377554 CCAATTTCTGGGCTTCCAGGTGG - Intergenic
959654851 3:108791650-108791672 GAACTCGCTGGGTTTCCTGGAGG - Intergenic
960591187 3:119367526-119367548 GAACCTTCTAGGCTGCCTGATGG - Intronic
961817687 3:129559681-129559703 GTACTTTTTCGACTTCCTGGAGG - Exonic
962823054 3:139071384-139071406 GAACTTTCTATGCCTCCTGTGGG + Intronic
966720850 3:183061479-183061501 GAACTTGGTGAGGTTCCTGGAGG + Intronic
968066924 3:195763979-195764001 GGAGCTTCTGGGCTTCCGGGAGG - Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
969561273 4:7949947-7949969 GGCCTTTCTGAGCTTCGTGGAGG - Intergenic
970293753 4:14605535-14605557 CAAGGTACTGGGCTTCCTGGGGG - Intergenic
971047224 4:22818181-22818203 GGACTTTCTGGAATACCTGGAGG + Intergenic
972743288 4:41909432-41909454 CAGCTTTCTGGGCTCCATGGTGG + Intergenic
972755553 4:42042276-42042298 TAGCTTTCTGGGCTCTCTGGAGG - Intronic
974792990 4:66714112-66714134 CAGCTTGCTGGGCTCCCTGGGGG - Intergenic
976023948 4:80664653-80664675 TAGCTTGCTGGGCTCCCTGGGGG + Intronic
976235681 4:82894065-82894087 GAACTCTCTGGTCTTTCTCGGGG + Intronic
977848216 4:101791093-101791115 GAACCCTCTGGGCTGCCTGGCGG - Intronic
978171606 4:105677802-105677824 GAACTCTCTGGTATTCCTGAAGG - Exonic
979410689 4:120375158-120375180 CAGCTTTCTGGGTTTCATGGGGG + Intergenic
981854962 4:149278542-149278564 TAACTTTTTGGGCTTCTTGTGGG + Intergenic
982881982 4:160731511-160731533 GAACTTGCTGGAATTCCTGAAGG - Intergenic
983112398 4:163768925-163768947 CAAATATCTGGACTTCCTGGTGG + Intronic
984891621 4:184498913-184498935 CAACTTTTTGGGGCTCCTGGAGG - Intergenic
985171243 4:187152720-187152742 GAACTTCCTGGGCTAATTGGAGG + Intergenic
987061687 5:14249442-14249464 GAACTTTCTGGACTTTCGAGGGG + Intronic
988644581 5:33080303-33080325 GATCTTTCTGGGTTTTCTGGTGG + Intergenic
991647413 5:68815086-68815108 GAACCTGCTGGACTTCCTGGAGG + Intergenic
992506088 5:77388995-77389017 GAGCTTTCTGGGCTCTGTGGAGG + Intronic
994015033 5:94955483-94955505 TAGCTTTCTGGGCTCCATGGGGG - Intronic
996129929 5:119769745-119769767 TCACTTAATGGGCTTCCTGGGGG - Intergenic
996777655 5:127150173-127150195 GAACTCTCTGGGTTTGGTGGTGG + Intergenic
997220384 5:132157364-132157386 TAGCTTACTGGGCTTCATGGGGG + Intergenic
1000569576 5:162895508-162895530 AAACTTTCTGGGCTTCATGCAGG - Intergenic
1002783321 6:383259-383281 GAACTTTCTTGGCTTGCCTGGGG - Intergenic
1003041352 6:2690393-2690415 GAACTTCCAGGGATTCGTGGGGG + Intronic
1003510926 6:6779766-6779788 CAACTTTGTGGGCCTCCTGATGG - Intergenic
1003978937 6:11371053-11371075 GCACTTTCTTGGCCTTCTGGGGG + Intronic
1007937045 6:45741672-45741694 GCACTTTCTGGCCTTGCTGTGGG + Intergenic
1008155462 6:48008736-48008758 GCCCTTCCTGGGCCTCCTGGGGG - Exonic
1010681817 6:78807564-78807586 TAGCTTGCTGGGCTCCCTGGGGG + Intergenic
1013980301 6:116121163-116121185 GGACCTGCTGGCCTTCCTGGGGG - Exonic
1014058501 6:117044012-117044034 TAGCTTGCTGGGCTTCATGGGGG + Intergenic
1014872642 6:126614969-126614991 GAGCTTGCTGGGCTCCATGGGGG + Intergenic
1017229503 6:152057535-152057557 GAACTTTGAGGGCTTCTGGGGGG - Intronic
1018812830 6:167309719-167309741 GTCCTTTCTTGTCTTCCTGGTGG + Intronic
1020604166 7:10315164-10315186 GAAATTTCTCAGCGTCCTGGAGG + Intergenic
1020874284 7:13673943-13673965 TAGCTTGCTGGGCTTCATGGGGG + Intergenic
1022826798 7:34022865-34022887 CATCCTTCTGGGCTTCCTGTTGG + Intronic
1024998539 7:55294837-55294859 TAGCTTTCTGGGCTCCATGGGGG + Intergenic
1028492017 7:91423263-91423285 GAAGTTCCTGGGCTTCCTGTTGG + Intergenic
1028991240 7:97051126-97051148 TAGCTTGCTGGGCTTCATGGGGG - Intergenic
1029115324 7:98233598-98233620 GCACTTTCTTGGCCTCCTTGAGG + Exonic
1029125034 7:98289664-98289686 GCTCCTTCTGGGCCTCCTGGGGG - Intronic
1030325859 7:108217842-108217864 TAGCTTGCTGGGCTTCATGGGGG + Intronic
1031452141 7:121935417-121935439 GAACTGTCTGGGCTTTGTGTAGG + Intronic
1031987005 7:128169696-128169718 GCCCTTTCTGCTCTTCCTGGAGG - Intergenic
1032721148 7:134551741-134551763 CACGTTTCTGGCCTTCCTGGTGG - Intronic
1033533316 7:142287958-142287980 GATATGTCTGGGATTCCTGGAGG - Intergenic
1034260930 7:149755022-149755044 CAACTTTTTGGACTTCTTGGGGG - Intergenic
1034521793 7:151626052-151626074 GAACTTTCTCTGCTTCCTGGTGG - Intronic
1034919885 7:155071031-155071053 CACCTTGCTGGGCTTTCTGGTGG + Exonic
1035123093 7:156585345-156585367 GAACCTGGTGGGGTTCCTGGAGG - Intergenic
1037260471 8:17001987-17002009 GGGCTTTCTGGGCGGCCTGGAGG - Exonic
1037271086 8:17131379-17131401 GAAGTTTCTGGGGTGCCAGGGGG + Intergenic
1037390689 8:18388101-18388123 GAACTTGGTGGGCATCCTGGAGG + Intergenic
1038382542 8:27110126-27110148 GAACTTTCAGGGCTTGGTGATGG - Intergenic
1040345538 8:46489275-46489297 GCACTTCCTGGTTTTCCTGGGGG + Intergenic
1040949821 8:52926115-52926137 GAACCTGGTGGGATTCCTGGTGG + Intergenic
1041669872 8:60481324-60481346 AAACTATCTGGGCTTGGTGGTGG - Intergenic
1041900642 8:62978639-62978661 TAGCTTTCTGGGCTCCATGGGGG + Exonic
1043366331 8:79537363-79537385 TAACTTGCTGGGCTCCATGGGGG + Intergenic
1044533122 8:93330465-93330487 GAATTTTCTCGGCTTCCTAGGGG + Intergenic
1044692352 8:94894049-94894071 GGATTATCTGGGCTTCTTGGGGG + Exonic
1045707409 8:104942097-104942119 GAACTTGGTGGGATTCCTGCAGG + Intronic
1046118087 8:109808754-109808776 TAAGTTTCTGTGCTTCCTGTAGG - Intergenic
1046478416 8:114780483-114780505 GAACATTCTGCGATTCATGGGGG + Intergenic
1047960936 8:130011200-130011222 AAGCTTCCTGGGCTTCCTTGAGG - Intronic
1048406077 8:134123492-134123514 GAACTGTCTCTGCTTCATGGAGG + Intergenic
1048863966 8:138745756-138745778 GACCTTTCAGAGCTTCCAGGAGG - Intronic
1048914131 8:139165597-139165619 CAACTTGCTGGGCTCCATGGGGG + Intergenic
1048915094 8:139175166-139175188 GAACCTGGTGGGGTTCCTGGAGG - Intergenic
1049490935 8:142901642-142901664 GTGCTTTCTGGGCCTCCTCGAGG - Intronic
1049718019 8:144102812-144102834 GAGGTTCCAGGGCTTCCTGGTGG + Intronic
1055894794 9:81162629-81162651 TAGCTTGCTGGGCTTCGTGGGGG - Intergenic
1055990771 9:82102798-82102820 AAACCTTCTGGGCTCCATGGAGG + Intergenic
1056176797 9:84043988-84044010 TAGCTTTCTGGGCTCCGTGGGGG + Intergenic
1056411669 9:86334321-86334343 GAGCTTAGTGGGATTCCTGGAGG + Intronic
1056922428 9:90802182-90802204 GCACTTTCCGCGCTCCCTGGGGG - Intronic
1057004671 9:91546837-91546859 GAACCTGCTGGGGTTCCTGGAGG - Intergenic
1057929889 9:99184354-99184376 GAGCAAGCTGGGCTTCCTGGAGG + Intergenic
1058163684 9:101596540-101596562 GACCTTTCTGGACTCTCTGGGGG + Intronic
1058215315 9:102225788-102225810 GAACTTTCTGACCTTCCCTGTGG - Intergenic
1058893222 9:109379111-109379133 GAGCTTTCTGTGCTTCTAGGTGG - Exonic
1060010685 9:120040712-120040734 GGACTTTCAGGGCATCCTGAGGG - Intergenic
1060300298 9:122371119-122371141 GAATTTTCTTGGCCTCCTGGTGG + Intronic
1061307346 9:129739745-129739767 GCACTTCCTGGTCTTCCTCGTGG - Exonic
1062535895 9:137020959-137020981 GAACCTTCTGGGCATCCAGCAGG + Exonic
1062721938 9:138049262-138049284 GAACATTCTGGACTTCATTGTGG + Exonic
1062729980 9:138103344-138103366 GGACTTTCTAGGCTCCATGGTGG + Intronic
1188757105 X:33975423-33975445 AAACTTTCTGGGCTCCATGCAGG + Intergenic
1190138848 X:47823115-47823137 GGACCTTCTTGGCTTTCTGGAGG - Intergenic
1191631938 X:63331244-63331266 TAGCTTGCTGGGCTTCGTGGAGG - Intergenic
1191962477 X:66718818-66718840 TAGCTGTCTGGGCTTCGTGGGGG - Intergenic
1192025522 X:67446461-67446483 GAGCGTGCTGGGTTTCCTGGTGG - Intergenic
1192800513 X:74460798-74460820 GAACTAGCTGGGCTTGGTGGTGG - Intronic
1192966561 X:76183202-76183224 TAGCTTTCTGGGCTCCGTGGGGG + Intergenic
1193705157 X:84812577-84812599 TAGCTTGCTGGGCTCCCTGGGGG + Intergenic
1194203123 X:90978991-90979013 TACCTTTCTGGGCTCCATGGGGG + Intergenic
1197581484 X:128289003-128289025 GAATTTTCTGGGTTACCAGGCGG - Intergenic
1197709765 X:129657045-129657067 AAACTTACTGGGGTTCATGGAGG + Intergenic
1197715350 X:129702314-129702336 GTATTTTCTGGGCTTGCTGGGGG - Intergenic
1197785091 X:130190852-130190874 CAACCCACTGGGCTTCCTGGAGG - Intergenic
1200214019 X:154359498-154359520 GAACTTGTTGGGCTTGTTGGTGG + Exonic
1200548955 Y:4554417-4554439 TACCTTTCTGGGCTCCATGGGGG + Intergenic